Description :
From Genome Similarity Track
Location :
Scaffold_70:299057- 301756
Transcript NameFunction/comments
Physo_139135hypothetical protein

Sequence
2699 bases(100 bases per row)
GTACAGTCTACAGTGTATGCCTTCGTACACAAAGGAGGGGTTCCCTGCTTACCTCGAAAGGCTCCGTCTCAGCCTACGAGTCCTTGTGAGTGTACCCCCA
TGCAATATTTGAACCATGGTCAACAGCGTTTCCCACCCATACTCGCACCTGTCTCGCTGCACTAAATTATGCCTATAAGTGTCGGCAACACCGCTTCATC
GTTAAAATAAGGCATCACGATACATGTCACGTGCTCTGGCAGAAGTTGACGTGGGTGAGTCTGCACTTGTTAGAAAGCTGGAAAAATGAAGACTGATTGT
TGTTTGGAGTGGCTACAAGCCTCTAGCTGTAGCTAATTTGAAAAGCAAAGAGTAGGAAAGCATGAAACCAACGCGAGCTGCGAGCGTGCAGCTCAGCGCC
GAGGATAGACCCGTAACCTCCGAGGCCGTTGGGTCAGGAGTTGCGACTGCGTCTTTGCGATTTCAGGACAAGATCGCGGACAATTTCCAGATCCCGATCG
CGAATTACTTCTACCGTCGTCGTCGAGCACGGCATCCCTTTCCGGATTCCGGACTCCAGCCTGGAGCTCCGTTCATTGAAGTTGGTGGAATCGATGCTTC
AGCTGCCGGGGCCTCCTTCGAACTATTACCCTCTGTATCCCTGACATCCTTGATAGGTTTCGTGGGTTTGGCAGTCGTGTTTTTTTCCGTGATTTTTGCA
GTCTTGGTAGTCTCCGCGGCCTTAGCTTTTGTCGCTGATGGTCTTGGTGGCACCGGGGAACCAAACTTGGATGCAGTTTGTGGGAATACGCTGTCGGTGG
CACCGTTCAAAACGTCTTCGATATAGTCCATGACATACGCTAGTCGAGTGTAGACACCTGCCTTCACGCCACATTTTCCGCCCCAACTGACGAGACCTAC
CAACACATCGTTGGCAAGAAGTGGGCCGCCTGAATCGCCGTTGCACGAATCCTTGCCCTCGCCATTTCCAGCGCACATCATTCCCTCCGTGATGCGGTTA
CCGCCTCCGTATTCCTTGTCGCATTCTGTGTTGGATATGATAGCCACATTCACCTCCTGAAGCGTGAAGCTTCCCACGCGATCTTCCGTCAACCCCCAAC
CGAGAACCTTGGCCATTGTGCCGACTTTGTTATCCGATCCATCACGTGCACACAGAGGCGCCACCTTCTGAGTCGAGGGGGTATTCAGCTTCAGCAAGCC
GATATCGTACAAATGTTTTCCGTTGTTGTACAGGGGGTGACGGAACCCCTGGGTCACTTTGATCACCTCGCTGGAACGAGACCCCGCGCCTGACCCAAAC
TCGGACCCGAGAGAAGCGTATACTTGCCCCTTGTCTGTCTTGATGCAGTGTCCAGCCGTGAGAATGTACTGAGTTGCAACCAGCGTACCACCGCAAAACG
TTTTCCCGTGGGGGTCGAAACGCAGGCTTGCACTGTATGGATGCTGGCGCACGTCCGCCTCGGAACCTCCATAGATTCGACTCTCTTCGGTGGTGGAAAG
ACCCGTGCTGGTGTTGGGCTCGGGATCAGCAATTGACGGCTTTGTTGTACGCTTGACACTGGAGAACTCGTAACTGTGCGCAAGCTGTGCTAGAGCTGAC
AGCAGCGAGATGCATACGCTGAGCCGCAAGAGCCGCATGATTCGTCACTCACCACTCGGAGCTGTTAGCTCGCGCGTGAAGAAATCCGAAGTGACGGCGA
GTCTGAGGCGTGAACACAGGGCACTCACTCTGCAACACCATCACGAGGATAAATTCTTTCATAGGGTCGATGTAGAATAATTGCGGCACGCATTAGTGAC
AGCGACAGAAACTTGGCGAGATGGATCCGCTTTCATTTGCTGTCGGAAACGGAACCTGTGTGTTGTTGCCCGTTGTCGAAAAAATATTTGCTTGGCGCCT
GGCTGATACAATGACCACCGCTGCGAGGATATCTGCTACACTTGGTATGCTCTACCGGCATGGTAAATGTTGTGTACGCACAGCGGTGTCACGACACCAA
GGCACGGGAGAAGTTCTGCAGGTCATGAAACCAAGGCAAAAATTTGCAGGTGCTACGGGTAAATTTTTGCCAGATATGCCAAGATGCCAGATCCACTTGC
ATTGGTATTTCTCATGCGATGCGATTCGACAGCTAGATCCACTTGCAATGTGCCTAACGCCAGCATGTCCTCCTTTAGCGTGAGTTCCTGTAACTAAGCC
CTTGTTTTTTCTTGAAGCTAGGCTACGTTTTGGAAATGCCAGCATTCTTAGTAAAGTTTGACATAACTTAGCGCTCTTCCTGTCGAAAACTGCAACTTGG
TATCTTGAACGAGTGCTGTACGCGCAACAATGCATTTCCCGGTATCATGCAATAGCATACGGCTATTTGTCGTGTTACTCCAACGCAAAATCGTTTAGCT
TAGGTGTCTACGCAGACTTCTGTTGTAGGACCGGTGAGTCGGTCGTCGGTACCTCGGTGAATTTCGAGGCCTTCGTGGCAGGAGACTTCTGCTCCGCCGA
GGATCCATCAAACGAGAATGTCAGTCCCTTCGTGGAAGGAGTCTTCTGCGCTGCCGACGATGCATCGCTGGTGGGTGTTGCCGTACCCTTCGTGGCCGTA
TTCTTGCTAGTCTTCGAGCCAAACTTTTTGCCATCTCCACCGGCAACAATCTCGTTAATGTAGTCCAGCACGGACGACACGCGGGTGTAGACACCCGGC