Description :
From Genome Similarity Track
Location :
Scaffold_136:29905- 33348
Sequence
3443 bases(100 bases per row)
GTTACAACGAAAATTCCGCTGGTCGCGCCAGCAAGTTGGCGATTACAAGGCGATAGAGGATGACATCAAAGCCGTACTGTGCCAGAACCCTACCAGAGAG
CTGATAACGCCGGTCGGACGAATCCCAGTAGACACAAGTTATCTACAGATTCATACGATGGACGTAGGCCCTGGTCAGTTTTTCATTGCGAACGAATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGAGTCGTGATGAGACTCTGCAAGGACGAGAATGTCGTCTCTACGAGCAAT
GGTTGGCTGAACAGCCGCCTGCGGTCGAGCGCCGAACTTACCCGACGCCGCGAAAGATCCTGCCGAGGCCACCGGATGCACCGCCATGGCCAGAAGGCCG
TCAACAAGCTCCGTTGGATGATGAGTACTCGTCACCCGATGTACATGGCTACGACGACGACCCCAGGGTCAGTGAAGGCTCGGTCGATGTCGCTCGAGCT
GATACAACCGATGTGGATCGTGCTGGTGGGTCGAACGATGGTTCGGACGACGAGGCCAGCGCGTCGTATGACTCGGACGTACCCGGAGATTCGCCGCCTA
GCCGAGTGGGTTGCCTGCCCGTGAATCCGAACAGTGGTGCTGAATCCACCGACCAGGGAGCGACATACGCCTCGGTTGAGGCATCGGGAGCCAGTGATGA
GCTGAGTGATGGTGACAGCGTGACGAACGACGGTTCGGAGGATGACCGCGACGTGGTAGCAGTGGCCAAGACAACTACATGGGATGTCCTGCCAACAGGG
ACCGCTGCGTCCAGCCTGGAGCCAGGAGAAACGCCGGCTGCGGTGTGTAGTAGCGAAGTCGACTGGGGTGTACACGACCCAGGGCCTAACGACGTTCCTA
CTGAAGCCGGAGCCTCCACCGCTGACGCCGACTCTGAATTCCATGATTCGGATGTAAGTGCGATCGATGACCCCGAGCAGCTACTGGAGGCGACCTATAT
CTTGGTCATGCATGCCATGGTTGCAGAAGGGTCTGGCGAAGGTGATGACACCGTGAACGATTGTTTCAGGGCATGTCGCAAACAAGATTAATCTCACCGA
GAACGCGCTGGAGTGTCTACCAACACCTCGACTGAAGCCTACCACACGGATTTGGCCCTACATGGAACGAGGTAAACCAAGACACGAGTGCTGATTCTCG
GTGGCGGGCTGGCCGAGGTTTCGAAGTGGAACGGACTTGAGATTATGAACCTGTTCGCAGCCGAACATCGTTCGTTTTGGTGGTGACATGTACGCGTTGC
GAGGGCAGCATGATTTGTTTGCACGTGGCCCAAGTCGCGGACGAGGACTAATTGCATACGTTAACGACGATTGACCTGCTCGCGAGGGTAACCCAGCTCG
CGACGACAGACGAAAGAAGCTACTGGAGATGATGATTGAACTGCCTGCGAGGGCTATCCAGCTCGCAGTGACAGACGAAGGAAATTACTGGAATTTGCAT
ATTACATGTGATGTGAACGAGTCACGATGGAGTGTCATGTCAGAATGCCTCGGTCGGCACCTCAGATGAAACGAAGAAGGATGAAGCTCAACGGAGGGTG
ACCGAGGCTTCGGACGCCGATATTAACGTGGAAAAAGTTCGCGCCCGTGCGCCGGACCTCGGCTTGCGACGAAGTATGGATTTGATGATGAAGAGGAGAT
ACGAGTGGATCTGGGACAGCTACGACCGACATGTAAGTCTCGTTCAAGACAGCAGTACCTGCTGTAGCCTGCGCGAAAACTGTGGGAACCCTCAACGAGA
ATTGGTGCGACACGATTGCAACACGGCGAGTCGTCGGGTGGAGGCTGGGGCACCCAGACTTTACGTTACGACCACCGAGTATTTGCTGTAAGAGCACCAC
GAACCACGGTCAACACTGGTACGGTTTCTCGCGCCAAATAGGAAGAAGCTGAAGGCACCACCGATGTTTCTGGTGCGGTGGTTCCCGAGCCGCAGACAGA
GGCAACTAAGCCCGAATTGGTTACGACCACCGGAAAGTCCGGATGGAACTGTGGAAAGAAGGCAGCGAAGTCACGGTCGACACAGCTACACTATCTCCGA
GTGATAACGAAGCAAGTCAAGGTGGGACCGACGTTGGCGGTGCAGCGATTCGTGGTCTTCAGGCTGGGTCAACCATACCTGCTTCCTTTACGACCACCGA
AGTTCCGACGTAGGGATGGTGTGAGGCAGGACGAGTCATAGCACGTTCCCTGACTACTGCACTTGACGTTGAACCCTCGGACGACGCAGAACTAGCTACT
GCAGATGCCGGTGATGCCGAGAAGTATGCGACCGAGGTGTGTCGAGCGGCGGTCCGATGGAACGTCGGACCATACGACCACCGGAACTCCGATTGTTTTG
CATTGCGGCCAGAAGTGTGGCAGGGCATGTCGCTCAGTTTGAGCCCCAGGTGATGCAGCACTATCAAACGCAGACGCCAATGCTGTCGAGGAGACTGAGC
CAAGGCAGGCCAGGGGCAGTCAGCGGGATGGCGATCAAGCGACCAACGTCGGACCATACGACCACCGGAATTCCGGTGATGTGACCATGGATGGGCTTCC
GCTTAGAGCGTGGCCGGCTACAGTACGTCGTTCCGATTACGTTTACTCGCTAGAGAAGCCGCCAGTGAAGCTGAAGAGAAAGGAATCACGATGCGAAGAG
CAGCCGTCAGCTTGATGTCGATGAAACAACCAACGTCGGATCATACGACCACCGGAATGGATCTGGCAGGATTCCTACTGCGCGCCCCGTAGCGGCTCCA
AGCGTCATCAAACTCTCGTTGGTCCCAGCAGAAGATGCAATATCACCGGAGGAACCTTGTGGTGTGTCGACCGACGCTTCAGCAGCGACGGAAGGTACTG
GAGACGGGGTCACAGGTGCCGTTTGTGCCGGTACCGTATTATCAGCGTCAACAGGAGCGCCGGTGGGAAATGAAAGATCTTGCGGCCCTAGCCAGTGTTG
CAAAGTGCCGGTGACTACATTGACAGCACCCTGGGATGCCGGAGAACAAGCTGGCGTCATTAACGAGGATCCAACTGATGGCGAAGAGCAGCAAGAACGT
CGAGCGTATCGGACCAGAACACTGAAGGTCCAGGAGAGCGGCGGTCCCAGCGGTCAGGCGCAAGCGCGATGAATGAACCATGGAGTTTACGGACCGGAGG
CGCCTAGACGCTCACCTGTTGTGGAGGCTCGTGTCCAAGCGGGGGCAGTTGTGGTATCGGATATGGAGATTATCGGAGCGATTGCCCGTCGCCCAAGAAT
CAAGGTACAATCAAGGAGCAGCCAAGTGCGAGATGGAAGTGGCTGCTTTGGTTAAGCTGACGACATTATCCTCGTTGGAGTGGCAGATAGTGGCAGAAGC
CTCGTCGGGTCCTAATACAACCCCGACCGAGGCTTCATGGTGC