Description :
From Genome Similarity Track
Location :
Scaffold_2071:2990- 4426
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2071-fgenesh-gene-0.360S ribosomal protein L6

Sequence
1436 bases(100 bases per row)
AAGACAACCAAGAGATTGTTAAAGTTCAGCAGGTATTTTCCTTTTGGATTAAACGATCAGCAGCTCGCCTAGCGCTCGTGTAATGCCATGGTCGCCTAGA
ACTTGAGCGCGTGGGCGCGGTCGTTCTTGGTGAGCGAGAACTTGGCGTTCAGGTACGCCTTGAGGAACGGCTCGGCCTCGATCGTCTTGATGAGAGCGGC
GTCGACAGCCTTCTGGTCCTTCTTGCGCTGGTCTGGGATGACTGGGGCCTGGGAGGGAAATCAAAGCACAGCACGGCGGTTAATACCATGTAGGGAGCTT
TGTCACAAGCAGCGATCCCAAGCGCTGATAAGGTGAAGTGCCTCATTCTCTCTCACGAGTGAGAGAAAGCGAGGACGACTTCGTTCACCATCAAGATCCC
CCTTATAGTGCAAGACACTTTCAGGGAGGTCTTGAATAGCAAAGAGTGTACAGTGACAAACGGGACGGCTGATGGTGGCGCTCAACGCAGGGTGATGAAA
CAGAGGAGGGGGCACTTACGGTGGCGGACTGGGCGAAGAACTGCTCCTCCTTGGTCTTCTTGGACGAGACCTTCTCCTTGGCGAAGTACGCGTCGTCGAT
CTCTGGGAGCTTGACGGCGGCGATGTCAACCTTGGTGGACGTGGCAATCACGTACGCCTGGTTCACGCGACGGAGTGGGACACCGTTGACCTTGTACGGG
CCTGTTGGAAGGAAAATAAGACAGAGATCATTGTCAGCAACCCTGTGGACAGCTTGAGATTTTTGTGGTCGACAGCTACATCGCAGCTCGGAGATGAGTT
CCTCAGCTCTCATAATCTTCATATTTCTTCGACAGGTGACCCCAGACAACGACCGCCCAGCCACCCTCCGAGGAGAATGTCCAGGCGACGGCGCACGATG
AGCACTCGACTCTTTCCACAGTCCACGCGCAGACATGAGGCCATAAAGACCCCAGTCCACATGTGTCCTTCTGTGGAAGAAGCCAACCGCCCGCCACGCA
TAGAGTCCGGGTTCGGTTGCCTCTCGATGTCAAGTTTGCATCATTGGAACCACTGAAGAGCGAGTGTGCTGCTGTTGGTGATTGGATGCATAAGACGTAC
CAGTGACGAGCAGGAGTCCCGACGCGAGCTGCTTAAGGAACACCACGCGCTTGCCACGGAAGCGGCCGGAGAGCAGGATGAGCACCGAGCCCGGCACGAT
CGACTTGCGAAGCTTGGCGGTCTTGACCGAGTTGCGGAGCGTCTTGGCCGACGGGAGCGGCTTCGGGATGTAGTCGGCAGGGTACCACTTCTTGGTCGAC
GGCTTGGACACCGACTTGACCTTCTTGTCGCCGCCCTTCTTGGCGAAGTTGCGGCGGCCGTTCGAGCGCGCGAGGCTGTTGCGCGAGATCGCGTTGATGC
CGCGCGCGAGAACGACGTTCTGACGCTTGGTCACGG