Description :
From Genome Similarity Track
Location :
Scaffold_1098:2990- 4170
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1098-fgenesh-gene-0.1HECT ubiquitin ligase

Sequence
1180 bases(100 bases per row)
TTAGGCAGTCGTGAAGCCGTACATGTCCGTGTCCAGCGTGGCGTACAGCACCGCCTTGAGGTCGCGACGCACGATGTGCAGCGGCAGGTCCAGCCTATTG
AAGCACGCGTGGCTCCAGATGTACCCGTCGTCCTTGAGAGGCACGCCCTTCAGCGTGAACGGACACAGGCGGCCGTCGTAGCTCGTCAGTGCTCGGAAAC
CCGCGATGGGGACGCGAGAAGACCCCGTCGCAAAGTGCAGCAGCCGCCGACGGTACTCGTTCGGCATCTCGCGCACAATCTCCCAGAACCAGATCAGCGC
AGGGTGTTCGTGCAGATTGCTTGACATCTTGGTGTGCTTCTGCCAGTCATCCACGTTGATCTCGTCTGAGCCGCAGAGCAGGTAGTCGAACTCCTCCGAG
TCGAACAGCATCAGCAGCTCCTGCGGGATGACCTCGTATAGACCCTTGAGGAACACGTACAGCTGGCTGGAGACGCTCTCAAAGAGCAAATAGCGGAACC
TGCACTCCAGGTACTCGTCCTTGTTGTCGTCCGTCAGGTCGATGTTGCGGCCGTTCGGGATCAAATCCACCACAACGATCTCATCCCCGCGCTGCTCCGC
CACGCTGAAGTCCAGTCCCAGCGCGTCCACGCCGTCGTTCTCCAGGATCCATAGTAGGTTCTTGTACAGCTCCGGGTCGAAGTGCTCCAGGTCGCTGAAC
GTGATCGGCAGTCCCAGGATGAGCTTGTGCAGCGGCAGCGACAGGTGGAAGCCGATCACCAAGCCTTCTAGCAATGCTCGTCCAATCAGCCGACCCGCGG
CGAAGTAGTACGCGAGGTGGTTCTCGCCGATGTCGTGGCGCGAGTTGGCGTTCAGGAAGAACGTTTGCTCCGCCTTGTTCGTGCACTTGAACACGCCGCT
TGAGGGGTCGGCGAGCTTCTCGTTCAGCAGCACGAACCACTCGCGCTGCAGCCCGCCGGCGTCGATCCCCGCCTCGTCCACAAAGGTGATGCGCATGACC
GAGCGGATGCTGCTCTCGGGGATTGCGCTCAGCGACTCGATCGAGTCCTGGAACAGGTTGGCGCGCGTCACGCTCAGCTTGATCACCTCGCGCTCGGCTG
GCACGATTAGCACTGCGGTCGTGGTCACGAAGTGCGCGTACTTGGCTGGGAAGACCTTGGACGCGATGGACAGCACGTCG