Description :
From Genome Similarity Track
Location :
Scaffold_1873:299- 3305
Sequence
3006 bases(100 bases per row)
AAAGTTGGGTATCCGTCCACGGACCGTCCACCGAAAAGTTATATTGCCCATGTTCGTAAGACTCCAAACGAACGTACAGTTAGTCCGTCGTTGGACGGAC
TCCGAAATTCTACCAGGTGTAATGGGCCtcaatacttaagcttacacgtgtgcgcacgtgtatgaggaagcgtaggtttcaTTGACTTGGCTTTATTATA
GTTGCTCTCCACAAGTATAGTTAAAACTAtattaaagataataatcAACACTTTAGGTTGAATTGAGAACTGTCTTTTATTTGTTTATTTGTAAAGTATT
ACCTCCTAAAtgtcatactatgtaataggggtttaccgacgggtggtcggcagaacCCTATAATTCTAATTGGTAGAAATATGCTGGTTTCTATCAATGA
GATCTTTAAATCCATGTCGTCTAGTCGTCTGCCTCAATGTAGCCATCGATGTGCCTTACACCAAGGTAGGAGGGTTTCTAACTTGTGGCAGAAGCCattc
tgttaggttacaagtgatgtagccgCTTGTACGTGTAANCCCCGCTACACAAAGAACGTCAAGTTGTAATCAGGACGGAGTAAtccagcaagctgctgga
tcaaGTGAACAAGAGTTGAGGACGCAGTCTTCCGAGTTATGGATCATTCAGGATGGCGTCCGCCTACCCAAGCCTTCCAGCCAGTAGCGCAGTCAGCTCG
ACGAGAGAACCTGGACAGGAACGAGTTTTGTGACAACTGTCGGGATTTCGGACACCGTACGGAGTACGGCTGGGCTGATAGCGTGTGTGAACTCTTCCAT
AGTATTGGACACCCGACGCGTCTCTCTGTGCAAGACACTCTCGTGCAAGAAATGTGAACAATTTCACCTCAGTATCTATAAGAAATACAAGACCATCGAA
CTTATCGAGGTCCTCGGTCGCATAGAGGCCCTCGAAGACTTGCCGAAGAGTGTTTTGGATCATGATCGGGCCGAACCCACGAAGACCATCAACCAATAAG
CCCGCTGGATGGGGATCCAGAACGTGCCAGACATAGTAAGACCCAGGGTTATGTGTCTTAGTATGTGTCGGTCCCGAGTTGAGGGTGAGGGAACAAGATA
ACCAACAATGCATGACTACTGTGATTCAGGATGATCTTGTCAACCCTGAACGATAACTTCTGGATTTTCCGAGCGTCGATGATCCCGTCGAGTTCAGGCT
GGGAGTAAGCGAGAGGTATGGTTGGTGGGAAGATCACGAGACAGAAGATAGACCAGATGTTGCGATGGTACACGGTGCGGTGAACAATTAAAGACGAGTA
TCCTGCTAGTCGCTGGGGTGTCCGTGAGGTTCATAGGCTTGGACCTTGCGCGTAGGCACATGCTGAATCTTCAGACTCACAAGCAAATCAAGGTGTCCGG
ACTAGGAGGAGTCCCGAGTTATATCTCCGCAAGTGCTCAGGTCAAGGTCACCCTCGGTCCGAGAGTCGTGTATGTCATGCCAGTATCGGTTGCGAACATT
GGTGAATGTGTTGACAATCTTCTAGGCATGGGCTTCATGTATGCCGCTGGAGTACGACTGTATGCGAGAAGGCGTCGCTCAGCTTCTGGACGAAGAAACG
GTTGTGATGCATGGAGGACCCTCGAGGGAACGGGTACGGTTGGATCTTCCAGTGCAACCAGGAGAACATGCGATTGTGCGTATCAGTTCCGGTCAAAGTG
ACCCTCGCCGCTACGTCATCTGGGCAGGAAGGGGAAATCGTTGGTAATCCAGGTTATATACGGAGCCAAGGCCTGGCCAATAGAGGTAAAAGCGATGGAA
ATTTCATGTCAGATGATATGGGTCGACGCCAACACCCGTGTGACCAGGATTGTTGAGTATGAGCTCTTTCCACAATCTGGACGGTTCGTTCGACCAGGAA
TGGGAGAATACAAGAGCTTATTCGTGAGTGCACGCAGCCCCCCGGAAGGGTGGACTCGTGCCGAACAACTCGCACAAATCGCAAGTGAGGACGCACCACA
ATGCGTCGAGAGCTCCAATTACACGTGACCGTCCAAGATCATGTTGATACCTAGTACTACTGAAGCCCGAGTGGTCTGCCCGCATGAACAACCCAGAGCT
TGGAAGAATAAGGATAAACGACGCTGGGACAAGGTCATGGGTGACGCCACTACCCAGACGAGTGAAGTTCATGACGCTAGCACTCAGACTGAGGCAACAG
CAGATGTAGTCATTTCGGAACATGGGGTAAACTCGACCAGATGTTACGTGGGAGATGCAAACTGGAGCCCGAAGACACGATTTTGAAAGAGGAGGCGTGC
AGACAGAAGTCGTTGAAGGTGCCGAAACGAAAGATGAGGATGAGCTGAGTCCTCCGATTCAAGCTGCGTTGCGTACGCATATGCAGAAACTGGAGCAGGT
GTATATTCAGTGTATGCGAGTGAGTTTGGAGGAATTGGACTTGGAACCTGCAGTCTACATCCATGGAGGTAGTGAGCTGATGTCACAATTGCGGGAAGAA
TAGGCTCTGCTTCCTGAATGGGAAGATCTCTGTCCCGAGTGCGATATTGACAATGCCGACGTTGGTGAATCTGGAAGTTCGTCCCCAGACGAAGAACCAA
AATTGATGTCTATTTTGAGGCGTTATCGTACGATCTTCCTGGCCGATAGGAATGTGACACCAGCACATGTACAGGGAGTGATATGCGACCAGTACGTAGG
ATTGGTTGCACCTTACCGGATGGTTAGCGTTGCTAACGAAGCTTCCGGAGAATGGTTTCATCGAACACTCAGAGTTCCGTAGGCTTTGCCGATCGTGATC
GTCGTCAAGATGAACGGCGTAGACACCCGGATGTACATCTACTAACACATCGTGAGTGTTTTGTTTTTTCAGTTGTCCAACTATCTGCGACCCCTGATTC
ACGATTTCTTGATTGGCTTCGAGAGTGCAATGTGGTTAATGAGGCTAGACATGATAAGTGGTTTCTGGGCGATCACCATGACGGAGCGTGTCAAGTTAAT
ATCTGC