Description :
From Genome Similarity Track
Location :
Scaffold_1433:299- 2034
Sequence
1735 bases(100 bases per row)
AAATCCAGCCACTTGTTCCTGGTGGATCTGCCCAGCTGTCGATACCAGTTTCTGGTTGGCCCCGCTAGCAGATCCGCAAATGTCAAAAACTTTTCGGCAT
CCGACGCTTGATCTCACATGAGGGCCGACTTGACTTTGCTGATCCATGTTCGCGCTCGATTTTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGA
TTTGGCTGAGATCCGTACCCTCTGGATCATACACGATCCATCCGTCCCGGCTGCAGCTGTTGCTACCGCCGCTGGTGAGGGGGATGGGACGTCCAGATCA
TCTGGGCGAACTCATCATGGGAGTTGTGTCCCTCCACTGACTTCATTTCCACGTCTCGTGCTCCGTGGTCATGGAACATTTGCGTTTGTGGCTCGGGCGC
TCTCATGCCTTGTTGGGCCAGGAAACGACTCATTGCAGCTTCGAAGTGCCGTTGTAATGTGCCTGAGGAGGTGTCGGAGGACCCTGTAGCCGTCTGGTCT
ACTGGCGAGGCGTGATCCGTGAGACGATTAGCTTGAACCCGATCCGATGATAATCCGACTGGCTTCTTGCTGGATCTGGCTCGATCCTGTCGCCAGGTCC
TTGCCCGCGCTTCCAGCATGGACGCCCCAGAGGGGCCCAAGGTCATGCGTCGCGGCTCGGAAGACGTATCTGACCCATCCTCAGCCGCGGATTCGTAGCT
AGAGGATGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGTGCGACCTTTCTCCGGCGATGGACTTGACTCTGACGAAGAGGTCCCGCGTC
GCTGATACTATGAGATCCAAGTCTAGCTCGAAGATATCCTCTGCATCGAGCGCACCAGCTACGATGCCTGAATCCGTAAGCAGACGTAATAGATCCTTGG
CTGCCACCAATTTGTTCGTCGTTTTCGTTGGTGCTTTCACCGGTTCCTTTGGATCTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATA
CAGAAAATCGCGTAGAGCTTGGTGGCGATATGCGAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCT
TGCATTTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGCTACTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAAT
CTGCAAATGCACACCATTTCGCCTTCACTTTCCCTTGTTTTGTTAGAGGATCTTGACTTGCGTCAAGATCTGCAGGGGTCCCCGAGGGAACCTGTAGACA
ATAGAGAGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAGGACTCCATCGATCCGTGGATCTTGTTTCATTCAGCAGC
GTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAACG
ATCCGGGCACGCGCACCATTGTGGAGTAGCGGGATTAGCAAAATCTGCGAGATTGCTGGATCCAACTTATTAACGGCACCCAGACACCGACTAACGGAGG
GGTGTCCCCCAATGATCCGTGATCTGCTGAACTTTCCTCACCTTGTGTACCCATCGGTAGGGCGGGATCTTGCTCTCTCGGTAAATTCCGAAGCGTTCAA
GTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGG