Description :
From Genome Similarity Track
Location :
Scaffold_2308:299- 1475
Sequence
1176 bases(100 bases per row)
TACCGGGATCGGTGCTTACAGACTGATcttgtggacgacgccagTTTGGGTCAGTGCAAACGGGTACAAAATGTTCGCTGCGGCCAGCAGGCTAACGCTG
GCAGCATTACACCGGGCTTGGCCGTCAAATTGAACTGGTTTTGCGGGGTGTGCTGCATGTGATGGTGTCAGACTCAAGGACTTTCACGTAAGGTGTATTA
AGCATTAATACATGTAGCGGCTGGAAGGTGTCAAAAGCAAGCGCAACAGCTGAACGCTGGGAATGCCCAGCCGATTTTGTCGAAATGTCTGTAGGGCTGT
CAGCTTGGCTTTTCATAAACGCGTCGGCGATGGACATCTCGTTTTCCGATGCAAATCCATGGGAATATGTCGACTACTGCATTGTGTGTACGTGGTTCGC
AGAATTCTACTGAAGTACTGCAGTGCTGAATACCACACAAGTGCTGTGCCACCTTCAATCTGAGCAACTATCTGCGTAATTCATTTTATGACTCCATTTA
TTTTATCAGCAGCACTTAATCCCGTCGAGGGAGCACTCCACGGACCATTTGCCTTAGCAATGTCAACGATCAGCGAACGGGCCATCGGGATTCGTTACAG
CCAGAAGGTTATGGCGTATGATTTGAGGAACCTAGAACCCTCTGGACGTCAGAAATTCTTGCCACGAGTGATTTGACGGCGCCAGACCGAGGGTCCATGA
TATCTTTCAAATACCAATGAGCCTTCCCTGAGGCAGACACTTCGCGATGGAGGAAGGCACCACTGGTAGATAGAAGATGTTTAAATGCGAGCGTTATTGT
GGTGCAGAGCTGGAGTTCGCAGACCTCAGTCTGTCATGTTTCGCTTCAAATCTGATGGAATAGATCGACTACCGCATTTTGCGTTGATGGATCGTTAATC
GAGGGTCTTCGATATTGCCAATATGATAAGACTATCTTTCGCGAACGCATCGACAGATATCTCGGGCTTTTTAGACTCCCCGTGCTACGAACAGATACAT
ATCCTTGTTGTACCAAACGCGATAATAACTTTCCGTATTGTGCGCTCTCTACGGGACCGCCCcgagctggatctgctgcgtccacTGACGCGCGAGCGTG
AGCGTGTGAAGTGCGTCTCTCTCTAAGACTTGAGTCCAAGCCATGAGCGTTCAAGTTTTGGAGGGGCATTTGATGC