Description :
From Genome Similarity Track
Location :
scaffold_199:29881- 31174
Transcript NameFunction/comments
Pl_107836HECT E3 ubiquitin ligase, putative

Sequence
1293 bases(100 bases per row)
TACTCGAAGCCAAAACCAGTGATTTCCATTTGGATCACCTATGCAATACAAAGACAACATCCGAACAATGAGACGTTTGAACAGCCACCTGCAAGCTACG
TACAGACTTACCAGAGATAGATATGATTTGAGATCCTCCTTGGTCTCGTACACTGGCAAATCGATGCGGTTAAAGCATGTATGTGCGCGGGGACACATTC
CAAGCGGAGGCGTGCCAGTTGGCACCATTTGCAGTGTGAACGGGTGTACGATACCACTTGCGCTGGTGAGCGCCCTGAAGCCTTCTACTGGTACGCGTGA
GCAACCTGTTGCAAACTGCAGTAGTCGAGCACGCTGGTCGTCTGTAAAAGAGCCTACAACATCCCAAAACCACTGGATCACCTCAAGTTCCTGTTCAATT
CCTTCTGAATCGTCATCCTGGGCTGCGTGTCGAACGCGCGAGTTGTTTTGCCAATCCGTGACGTTTAGTGTAGGTAATCCACTGAGGTAGAAGTCAAGCT
CCTGATAGTCAAAGATCGTAAGCAACGACTTCGGGATAACCTCGTATAGCCCCTTGAGCAGCGCAGTGAGCTGGTCAGACACGCTATCCAACATCCGGTA
GCGTAGGACGAGCGATAAATACTCAGTCTTGTTCTCATCGGTCACATCAATATCCTCGCCACCAGGTTTCAGTTCCACCATCTCACCGGACGGTGTCTGA
ATGCTGAAAGTCACACACAACGCGTCCACGTGATCATTATCACGCACCCAACACAAGTGCTTATAAAGTTCCTCGTCCAGAAATTCCAGATCGGAGAAAG
TAATTGGGACGCCTAAGAGGTGCTTTAACAACGGGAGTGACATGCTTACTTCGAGCACGAGGCCATCCAGTATAGCCTTGCCCAGAAGTCTTCCAGCAAA
AGTGAAATACTGAAGATGATCTTGTCCTTCAGGTACACATTTCGCGGACTCTGAGTTGATCCAGTAGTTGGAGTCCTCTGCGTGTGTTGTCACGAAAAGA
CCTCGGTCAGCGCTAAAAAGCTCCTTACACACAAGCCCAAACCATTCACGTAGTACTCCACCAGCGTCGAGCGCTGGTTCCCCAATGAAGCCGATATTCA
AATGTTCCTGCATCCTCGATTTGTCAACATCAGCGCCGGCCAGCTGCGGCAACGAATCGTCCAAGATAGAGCCACGTCTCACATCAATCTTGAACATGGA
CTCTGTGTACGGCACGGCAAGATTTGTGATTTGCTTGAGGAACCATCGTTTTTTCTCTCTCCACGTCATTGCCAGCACACCTTCAAAGTCTAC