Description :
From Genome Similarity Track
Location :
Scaffold_213:29878- 31648
Transcript NameFunction/comments
g9088.t1hypothetical protein

Sequence
1770 bases(100 bases per row)
GGTTCAAAGCCATTGCAGCCACCGGATGCAATGGTTCCACTATTTTTGCCGCCACCGGCTGCAATGTACGTGCAGACTACTATAAAGAAAGCGATGCTTT
AGAAAAAAAGATAATTGGCACAAGCACTGACTTCTACCCCAACAGTGCGAATAACAACAGCGCACATTTGTCTTTAACTTAAATGAATTTTTCAGTTCTT
AACGTCACTGAAACGATAAGATAGTGCTATTCTGCAGTTTTTCGTGAATTTATTTATTTCTCAATAGTGAGAGCCTTGTGTGTTCTATGTTTGTGTTGCC
CAACACGATGCCATTCTGTGTGGTTTGTCAGTTGTATGTGTGATGGAGCGTAGGTCTATGTATTATGGCTCTGTTTCCATCCATTTCAATGGTGTGGTTA
AGGCAAAAGGAAGAGAATATGCGGTAGTTATGAGCTGTTCTATGGCTTAACACCCAATCCAATCGGTTTTAAAAAGTGGGATCTGAATCGGATTGGAAAA
AAAAGCTGACTTGGCGCAGATCTATCTCACCTCACATCCCTGGGAGCGCCGCAGAACCGGAAAGTTTCCTTTGCTCAAGCATGAAGTTCATGACCAGCAC
CTAATCAGACTGATTGGATGCGATGCAAGAACAGTGCATGTTGTCGACAGCGTGCCTGGCGAGTCTCCGTGGCCACCGTGGAGTTCATGTTTGAATAGCA
AACCCCATTCCGGTGGCTGTGCACATGGATACAAGCAGAAGGTAGCAATCAGGATGTCTAGAAACGAAAATCGTACGCTGCCAAGACAACGACACTTGCC
TGCCGCAGTGAGTTCCAAGAGTGAAGCGCCTGGTTTCAGCAATAGAGGCTTCAGGCGATACGCAAGCCCTGACGATTGCCAGCAGAATGTACGGCGCGAT
TTGTCGTCGTAGCAGGTCTGAAGCGCAAGATCGCGCGCAATGACCTCGAAGTGGGCCATGCAGTTTGCATCGCAAATGCCTGGTCGAGCTTGGCACGGTG
GCGAACACCGTCGAACGGTGCTGACCAAAGCGGAGCCGACCCCATCTCCGAACCTCGCACGAGTAAGCAGCACTGCGGCCGTCGTCCAACTGGCGCAGTG
TAGGTTGCATGCTCATTCCGACGGGCTTTGCCCGCCATGATTTCAGCGACGCATCCTCCACCGCATTGAACACAGGTGGTTGCGCATCACCGCCGTCTAG
TCCATTGACCGCGCCGAAAGGAAACTCGGCCAGGCTGAGCTTGCTGTCGGCTCGGAGGGCCCAAGCGCACACCCAACACTGCCGGTGCTTTTGCGTTTGC
AGCCTCTCGCCGGTCTCTGCCACGTCAGAATCCCATATGTGTGCGCCACATAAACTGGCCATCTGGTTATTGGCTTACTTGAACTCTGTATGCTCTTCAA
AGGTCGCGGTGACGTTCACTCTGTCACCCACCTAAGTATCTTTGTCTTGCGCCTTTGCCACCGCACGTTCATTCGCGAACTCGCCGGCGGGCCCGCACCA
AGCAGCTCCTCGCCCCCTCAGCGCCACAGCGTTCGGCTCCCGCGCTCCCCGTTCCAGACTCCCGCAGCACGATGCTCCGCTCGAAGCGCCTCCTCGTGAG
CCGCCGCGTGGGCTCGAGCCTCGCGCGCGTGCAGACACGCGACGCCAGCAGCATCAAGAAGCTCATGGCCGCCAACCGCGGCGAGATCGCCACGCGCATC
ATGCGCGCGGGCAACGAGCTGGGCATCCGCACGGCTGGCATCTTCTCCAAGGAGGACCGTTTCACGCAGC