Description :
From Genome Similarity Track
Location :
Scaffold_2:29873- 60553
Transcript NameFunction/comments
Phypa_INRA-310PPTG_02075hypothetical protein
Phypa_INRA-310PPTG_02076hypothetical protein
Phypa_INRA-310PPTG_02077hypothetical protein
Phypa_INRA-310PPTG_02078dolichyl-diphosphooligosaccharide-protein glycosyltransferase 48kD subunit
Phypa_INRA-310PPTG_02079kinesin-like protein
Phypa_INRA-310PPTG_02080hypothetical protein
Phypa_INRA-310PPTG_02081adenylate kinase
Phypa_INRA-310PPTG_02082hypothetical protein
Phypa_INRA-310PPTG_02083kinesin-like protein
Phypa_INRA-310PPTG_02084hypothetical protein
Phypa_INRA-310PPTG_02085hypothetical protein
Phypa_INRA-310PPTG_02086carbohydrate-binding protein
Phypa_INRA-310PPTG_02087carbohydrate-binding protein
Phypa_INRA-310PPTG_02088hypothetical protein
Phypa_INRA-310PPTG_02089phosphatidylserine decarboxylase

Sequence
30680 bases(100 bases per row)
TAAGTCGTGGAGCTCTTTCGTCCCCATGGTCGAGTTTGCGGTCAACAATGCTGAGCACGCGTCGGCGGATCACACCCCGTTCTATATCAACTTCGGGCGG
CATCCTCGCGTTCCAGCGCTCCTTGGTGTTGAGCGCTCCTCCTCCGCTTCTGATGCCACCCTGGTGCCCCTCCCCGTGGTGGGGTGGCTCCGGCCTCTAT
CAGCGCGGCACTGCCCCTGACGAGACCGCGCTCCTGAACGGTGTTACCACGCGAAGCAGCGCTGCTGCAACCACGTCTGTTATGCCCACACGCGCCGCTA
CAAGGGCGGCGCAAGGGCGGGCCCAGTCATCTCACCACGGTCAACTCCCACCCGGAGCGACTGGACCAGTGGCACAGAGTGTCGCCAACTAGACTTCAAG
GACATTGATCTCCCCACGGTGCCGTCGAGCTGTCGCCGTCGAGCTGTGGAGTATCGTGATGTCCCTGACGGCTAACTTCGCTCTTCTTCCCGCGCCGCAG
CCTCGAGTTGCTGTGGCTGTTCATACCTTCCTTCATCAGCGCAAGTGTGTAACTCGTTACGCTCCGGACTCCATCGCAACGGCAGTCGGCTGTCAAAATG
AATATGCGGACCGGTGTGGACACCGGAACATGGATACGTTCGCCGTTGGCGACCGTGTGTTGTTGTCTACAAAGGGGGTTCATTAGTCTGTTGTGATTAA
TTTGAGCGCGAATTAGCTCGCGCCGAGTTTATTTGGACCATTCAAAGTCACGAAGGTATTAGGGGATACTAAGCCGCTCCTACTTCTTACCGCTCTACGC
CTCCATCCTACCTTCTACGTCGGACGACTCCGACGTTATCACCCGCCCACCATCCCTAGCGCCGACGATAACCCCGCGCCTCCGCCTCCCATCAATCGTG
GTTCCCCCGCTCAGGGCGCGGAGGCTCCTCCAGCTCCCTGCGCAGCTCCGCCATCTCGCGTTCCAGACGACTCAACCGCTCCATCGCGCGCTGCCGGCTT
CGGACAGCCTCGGCCTCCTCGCGCTGGTCACGCTGCACGGTTCCAGCGTGACGGCCCTGCACCACTTGTTGATAGTGATGGCCACGTCCTTCATATCGTG
GAGGTGATCTTGGGGCACGACGATCATCGTGCCGCTCCCCAGTGTACGCGTTCGGGTCGCGGGGCTCCCGCCCGCGACGACCCCATCCCTCTGCACCGCC
AGTATCTCGTGCGTTGGCTTGGCCCAATGGCCTATATCTGGGAGCATCGAGTAGTGCGTTCCGGACTGCGCGGAGGCGTACGGGGCAACGACTCCAGCGG
CTGCAGGTCTTCCGGGTGGCGCGGCCGCCCACCGCGCCTAACATCGCTCATTGCCCTACGGTATTGCCCAACAAGTTCTCGCTCCGCCTCGGAGACTTGA
TATTTTTCCTGCTCCCATGCATCCCAGCTGGGTCTCGGGCGACCGTTTTCCGAACACCAGGTGTACCCACTGGTATAATCCACATAACAGCAGCCGCGAT
CAGCGTCATACGCTACCTTGTGAACTCGCCTTGCCAGCGCGCTTCATGCTCCGCTTCGCGTCTTTCAAGGGAGGGGATGAACCTAGTGGCGCCATCAGTG
TTCCAGCGGTTCGCGAACGACGTCCACGCGTTGTCCAGCGAATTCAGTGTCACGGTCCGCGTCACCGCGACTGGCTTGCTGCGAGTCCGTTGGTGGTGGT
GGAACAAGCTCCGCATCTCGTCGTCACTCAGCGGCTTGCGTATGCCGCTGTAATCGTACAAGGCCCACCTTCCTAACTCCTTCACGTATGTGTCGAAGTC
TCCTGCGTCTGGCACGGGCCTGTTCTCTGTGTCTGCTTCTCCACCACCATCTGCCATTGATCCAGTGCTTCTGTCCTGTTGTTCTCCAGCTCAACTTGAT
TAGTGACCGCAACCGTAGCGGCCACGTGCGTATCTCCGAATCTTAGTAAGAGGTGGTGTGACAGGGCTCTGTCACACGGTTGCCACCGTGAGTGCACGGT
GGCCAATCAGATCCCAAAACTAGAGTTAAGAGTTAATGGCTGTGACGGCCTTGATGCCGTCACGTCAATCAACCAGAGTTTAATTTACCTGCTTTCTTCA
CTACAGTGTGTGCTTGGTAACGGGTTGTCCTTAGCCCATTACATTGGTGATGCGTGGCTGAACGACAACGCAATGCGAGCGGCTGCTGCATTCCTGCGCG
GGTTCAAGAACAACGCGGTAGTCGTCCTGCCACCTCCCAAAAAGAACCAAAAACAAACAGTACCTGATCCGACGTTGGAAGCCATTACTGCGATGGTCCA
GACGCATGATTAAACTTGGAAAGACCTGTCGATTTCTGATTGCATTATTCTCTAGGGAAGTCAAGTGAAATAATGCCGACAGATTCTGGACTCAGTCACT
TGCGAATGTTCGCGGCTAGCGCGCATACGTGTTGTCCATGGTTGAAATCTGGTTGAAACCGTAATATGCGCTGGAAATAAATTTCTTGCATATGATTCGG
CCTCAAATCACGATACCTGGAAAGAACCTAGACTAAAACTAGGTCATACCTGGGATTATCAGAAGTCTGAGTATTTTTCCATAATCTGGAAAACCTGGAT
GAGATGGCTGCTCGATTTATCTCTATCAGAAAAAATTAATATTCGGTAATCTTTAGATGTCTATAGCTGGACTTTTCGTACGCAGTTCACTTGCACACCA
TAGGATTTAATTATGGATATGAGATGCTGCAGGTCAAATGCATAATGCATGCTCTTTTAATCGAACTCCACGGTGTAATCTACGAAGACGTGGTAGAATA
ACTCCGGCAGTAAGTAACAGGTAGCCACTATGTGCTCAAGGATAAAAGCAAAGCTCCGTTGTCAAGGGGCGGCAATGTATCCACACAGAGTGGCCTCCAT
AGCTGGTTGGACGTCGAGATGGCAATTACGCGACTCGGGGTACTACAAACTGAAGAATAACACAAGTTGGGGCGTCAACGTACCAACACTTTAGTTGTGC
AATAGCAATAGAATGTTTCAGTACACTTTTCTTGATGCTAACACGCATGCGAACTTATGGTTGCAACTGGTTCTAATACATTAGTACTGGATTATGGATA
TTCCTCCATTTTTTTTTTTTTTTTACCTACGTCGGGACACAACCTGTGTCCACGCTGAGGTATGCTGGCAGAAATCCAGTTTGTGCATCAACGCACAAAG
TTTCTGACAAGCTTGATCCTGTGCATCAAGCACTGCAAGTTACTTACTACACTCCTGGCCAAATTAATCCGGCCACCCACACTTTGTACTGCCAATCAGT
CAATATTTGGCATTTGGGGGTGCGCTTTTGATATGAGTTTTCTATTGCTTAGAGAAAGAAGGTGTGTGTGTTAACGATCGGGATTTCGCAGTTTGAAGGG
TAGCTCCCATACAATAAACCGATTTGGGCATGTGGTCCAAACTTTCGGCCACCCTCGCCTAACCCTTTCCATAGTAAAGTCAAAACAAATGTAACGAAAT
GATTGTACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTAGTACAATCATTTCGTTACATTTGTTTTGACTTTACTATGGAAAGGGTTAGGCGAGGGTGGCCGAAAGTTTGGACCACATGCCCAAATCGGTTT
ATTGTATGGGAGCTACCCTTCAAACTGCGAAATCCCGATCGTTAACACACACACCTTCTTTCTCTAAGCAATAGAAAACTCATATCAAAAGCGCACCCCC
AAATGCCAAATATTGACTGATTGGCAGTACAAAGTGTGGGTGGCCGGATTAATTTGGCCAGGAGTGTAGTACTCCAGAGTACAACAATCGTTCATCGCCA
TCCTTCCGATCTGCTCCCTACCCCTTACCGGTATTACAGGGTTTATCTTGTTTGCGCTTGACATTGGTCTGTGGAGAATCGCTTTGAATGATCTATATTA
TAATTATAATAATAATACCAGCGGTTGGTAAGACCAGCACAACCCAATCTGGTTGCTTCGTAAGTAAGTATTATTATAAACATCGAAGTAAACTTATGCA
AAATCAAGCGTTGTACGTGTATTGTGCATTTGAAAAATAAGGCTAGGAAGCCGCTGATCATACTTTGCCCTGAATCTTGCTGTGAGGTTTGGTGCAACCT
GGGTGTCCACAAACGCGAGCGCGATCTGCACAGTTTCGAGTCAATACTTTCGACGGCTCGTTCGATGCATGATGCAGTTTTTGTCGCAAAACCAGGACTG
CAACGACGCCAAGCAGAGTATCCACATGTGGCCAAGGAAATTCAGTCCTCGTGTCGCTGTGGACTGTTGATTTCAACGTTGAGCATACCCAGACTTGGTG
CAGCTCCACAGTCTAACGCCGCAGACTTTACATCGATTTTGCGAGCGATATTAAACGCAGCAAGGCTCCCTCTGATCTTCACTTCACTTGAGGAGAGGTA
GAGCCGCAAATCCTACAGGCGTTCCATAGAAACTTGGACATGTAACGCTCAAGTTGCAGGCAACTGCAACCGGTACCGTCCCGAGGACTAGTTGCCTCCC
CCCTCTCCTGAAGCGATCGCTGGCATCGCCCAGCGAATGCGAGCTTCCGTGCCGATCAGGTGCCCAAAGCGAGAAGAATGCATTCGCGCTGAATACTTGA
CCTGCAGCCAAGCACCGAGTCTGGTGAACCCTATCCGCGATGTACTGTTGCCATGATCTACACCTCACTTTTTTCACGTCTTTGGCAGCGTGCTTTCCTG
GGACCCGCCTTCATGATGAAGGTTTCATCAGCAGTGTCGACACACATAGTCGTCCAGCGATTCATCCTGCTCTCGTAGCTCCTGCATTCGTCGCTTTGTG
CGGAGGAAGATCCCGCTTGTGTGCACTAGCGACACGTCCTGTTCGCGAAACGCTTGGAATTTGTATGAGGTTGCACCTGAGTGCAACATCATACCAAATT
CAAGATAAAGCGTGACGTGACACACACACGGACAGCTATACATGTACCTGCTGTGTGGGAGTCGCAGTGTCGCCATCAGAGAGGGGGCAGACCGCTGTGG
TTGGTGGGTTGCTCTGGCCCTCAGTTCGAGTCCAAGCGCAAGCAGAACAAGCCCAAGAAAGAAAAAGCGAACAACAGGGACACTATGGATCTCTCCATGA
TCCTGAGTCCTGCCCTCGAGGAGGAGCAACAGGCGCCGCGCGCCCCTCCCTTTCGTCAGGAGCGTGAGCCTAGCCGCAAGTGGAGTGCTGACGAGCTCCA
GTGTGCCGTGGCGATCCTCCAGGACTTCCAGCAACCGTCGGCCGATTCGCCCGTAGCTTCGCAGGTTGACGGCATGCATAGCCGAGATGACGTCAAACCG
ACGCCGTATTACATTCGTCAGGAGCAGGGGTACAAGCAGGAGGAACGAGAGCCTTTTAAGCCGATTTTCACTCGGTCGGCCGACGATGCCGTCCAAGCGG
CTGCTACTGGTAGCCGCCGGGGCGGAGAGGAAACAAAAAAGAGAAAAACTCAGAAGCAGAATCCCTCTTCCGCTGCTTGGGAAGAAGACAAATTGTCCAA
ACTAGACCTACTAGTCCAGGCAGACGCCGTCATCAAGCGTCGCCCTACCAAGACACCGTCTTCGCCCTCATCGAACTATCTTCGCAGTGGAGTCTGGTCT
CTTGCTGAAGAAGAGTACGCCGCTGCGCTCGTGTCCTTCTTCCTTGAAGGACTACTGGACTTACCCGAGGGCGTGACGCTCCGCAAGTTCCTGGCAGAGA
AATTATGCTGCAACCGCCGCCGCGTCTCGATGAAACTAGGAACAGAGTCATTGGCCGGTCGGAAAATCCCTAGGAAGGTTGGAGCTTCGGTGTTTGTAGC
TGCCAATCCTCCTCCAAGTGAGGAGGTACGACAGGAAGTTGATCGTGAGTTAGCAGAGCTCCGAGAGGCCAACTTCACCTCTGGACTATTGAACAGCCGC
CGTTACTACGGCGAAGAAGGGGATGACATTTATTCACAACAGCGCAGACTGTATAAACTGGGTGAGTATGAGGAGGAGGACGACGACGATGCATTCCGTC
TCCACCAGAAGACGCCTGGTCATGGCTACAAGAGGAAGGCAGATCGAAATGACTTCAAGCCCAAACGCGGCAAGCCAACAATCATTCGCACAGGTTTCGA
GTCGCCCGAAGAGGAAGAGTTCGTCACTACGATGTTCGAGTACTTTACAGCCGGATCTCTGGATCTGCCTGAAGGCACGAAGCTAGTTACTTACCTGTGC
CAACAGCTAGGCTGCACGCCGAAGCAGTTGTCTATGAAGCTTGCACCACAGCGCATGGGCGAACGCAAATTTCCGGACAACGTCGGCTCCATTACGTACG
TGCGCAAGGTCACAGGTGCAGGCAATGCCTCGTCGGATAGCTCGGATGACGATGACTTCTCGGAGGAGCTGTTTGAGGTGGAAAGCCGCATCACGGAGCT
GCGTCTTGCTCACGAGGAAGCGCATAAGAAAGTTCCTCCACCAGTGGCCACACCAGTGAAGCGCGAGCGTAAGCTCAGCACTGCCAGTGTATCTAGCGCT
GGGACAGCGAGTGTGGCCAGTACGCCTAGTGTAAGCCCTGTGCGTGTGTTCCGGCGTAGTGGTCCGTGGTCGCACGATGAAGAAGTGTATGCAGCTGCGC
TTATCGACGCGTTCTTTAAGGGTGTGCTGGATGTTGCCGAGGGAACTACGCTGCGAGCTTTTCTGTCGTCACGGCTGTGCTGCAATCCCATGCGCATCTC
GAAGAAGCTCGCGAGCGAGTCCATCGCTGAGATCCCGATCCCGAAAAAATTGGGGAGCTCAACGTATGTGCGTAATGTTGAAGTGACCCCGGAAGAGCAA
GCGGAGGCGGAAGACGCCCTCCGCAGCCTTCAGCGTGTTTACATACACTCGAGTTCGAGCAAGAGGAGAGGCGCCATTGGCTCCAAGCGCCAACATCAAT
CTCGTGGACGTCGCAACCGTTCCTTGGCGACCGCCCTGAATACGGACTCGGATGGCACTGAATCAGACTCTGATGCACACAATCTTGTATCTCGCGATAT
GAGCCCCGGGAAGCTCCAAAAGACTGCAAAGACCCACTCACCAGCCCAGGAAGCGCGAAGGCAACGCTTCAATGTGCCCCACGCCGGTCCCGAGCTAGTA
GTGCCGGCACCGCTGAAGGAGCAGCTGGCGTAGGCTCTTGATGTCGTGCTGGGGAGACCAAGTTATAAAATTATGCATGTAATTGCCTTTCGAGATTGCA
ACCAGGTACCCTTCATCAAAATATTGACGTGTTGATATTCTCGTTCCTTACACCACGCACAATTACAGTGCAAGCACACTGCTTGAACTTCAAAGGTGCG
GGTTGATCGCAAACTAACTCCAAGTTGTCGAGCAGGCATGGTTTGGTTTTTGTGTCCAGGTGATGTGAGTTAATTTCAAGCAAACAAAAATTCTAGCACA
CACAGATAACGATAACCAGTTGAAGGCCAATCAATTGAATTGATGAGTTTCGTCACCCTTTACAGGCATGAGTCTTCATTTTCTGCTAGACTCGAGTCTC
AGACGCAGAAGCGGCGTTTACGTCCGCATTCTTACTTCTTACCATCGTAAAACAGGAAGTACACGCTGAAGAGGAACACACCAGCCATCATCGAGAAGGC
CGAGGCGTAGTACGGGTATGCAGCGGGAATGAAGCGTTCGTATTCGTCGTGCTTGAACGGGCGCAGTGACACCTGCGTAGTCGTATAGATCGTAGAGAGA
CCCAGACGGCGATACATCACACGGAAGAGAAAGATACCATACACGTCGGGAGCCTGGAATGTCACCGAGAAATGACCCTTATTGTCGTGGGTCAGCGTCG
TGCGCACGTGCGGGTCAAGCATAACGAACTCAAGTTGCACATCATCCGCTTTGTACGGCACCCATTTTCCATCCTTGAGCTCGTGGAGGTCCAGAGAGTA
CGTGAGATTGTCTTTCACACGGTACACAAGCGAATCACGCGCCACCTCAGCGTCCGGGTAGAGCGTGATCGGCTGGTCGCCACGGTTCGCGTCGCTCAAC
ATCTTGGCCGGCTGCGAGCCGTCCTCGCGGTGGTGCTTCACGTTGGTCATGCGCAGAACGCCACTCTCCTGGAAGCCCCATTTGGTCACGGCGTCGGTAA
ACTCGGCGTTGGCGAAGTCCTTGTTGTCGAAATATTTGTCGCTGAAGAGATCGAGCGAGCCAGCGAAGACAAGACGGGCGTTGTTGCGGCCCTGGACGGC
AGTCACTAAGCCGATCTGATTGCCGAAGAGCAAGTCACTGGCCACTACCTTGTCTGTGATGGGCTTCACCGGGTTGGCGGAGTACGCGGTGGCAGGAGCC
ATGAGAGCGTGGAAGGCCAGGATCTTGTTCGGCTCGAGCGACATGCCCACGCCGGAGAAAGCGACGGTCTTGGGCTTAGAAGCAAGCGATCCAACCACAC
GCTCCGAGGCTACGAAGTCCTTGGCGGCGATCACCGAGTTGTAAATATCGTCTTCGTCCGCGATGGGATTGACGTGGTCCAGCACGACATTGCCCTTCTT
CTCGAACTCGACGCCGCACTCGAGCGCAAACTCGCGCTGCACCTTAGTAATCTTCTTACTAGCCGACAACAGCACGTTGCCGCCCTCCTCCACGAAATGC
AGCAGGTCAGACTTGCGCAGGGAGCCCAGCGCCTTCTGGGGCGTAAACAGCACCAGGTTCTCGTACGTGCGCTCTCCAAAGAGTTCCAGCTCCAACGGTT
GCTCCTCCTCGCCGGAGAAGAAGCTCAGCTCATGGCCGCGGGCTGTATTATACAGACAGGTAGAGCAGAATGAAGAGAGTCAGCAATTGCATCAACGCGC
TTTGTGTCGGAAACATCGTCGCACCTTCAAGCAGCTTGAAGAATTTGGAGTGCGTCTTCTGCAGCTCCGGAGATTCCAGCACTACAGCAGTGCGCGCAGC
CTGCGCAACGGCCAGCGCCAGCGCCACAGACAGCACCGAGATAAAGGAACCGATCGACATTATGGGGTCAAGCAGATCCGAAATTGCGGACGCGTGTCAA
CGTGGTATATATTTATGCCGAGTGAATAATTTTGTGGTATGTATACTGGTATACTGTGTATACATGTTGAAGCCAATGTTGACTTATTTGTGGACGCTGT
GCTGAGCGCCACCTGCGGCTCTATTAGTCTATGATAGCCGCTGCTCCACCCAGGGGAGCTCGACGGATACGTCGCCTCCGTTCACCGAGTGTGACAGCGT
CGCGGCGGCCTCCAGGGCTGCCACCGGTGCAACGGCAGCGGACACCTGAGGTTCCGTCACCACGGGTTGAGAGAAGTCCTCGCCGGCTTGCAGATTATGG
TACAACAGACTTGTCGGTGATTAGCGAGGCGGGACAGGGTGATATCAAATCAAAAGGGCGTGCAGATACGGTGCGCGTAGTGGTCCGATGCCGACCTATG
AGCGCAGCAGAGCGCGCAAGAGGGGACCAATCAGTATTTCGTTTTCCGCCGAAGCAGCCCACGACACTTCAAGTCGTGTCCACTCAGAACAGCAGCAGCA
GTAGTAACAACAGTTCAGGGTCAGCTCGTGAGCTTGTCCGCAGCTTCCAGTTCGACTTGTGCGCATCGGAGGAGCTCTCTCAAAGGCAGTTCTTTCGTAC
TTGTGGGGTGATCCCGCTCCTCGAGTCAGTGGTAGAAGGGTATCTCGCTACTGTCTTCGCTTACGGCCAAACCGGATCAGGCAAAACTTACAGTATGTCG
GGCCTCAACGAGCTGTTAGCAGGTACTGAATTACGCAACGAGGGAATGGGGGATTCCAATGCAATGGATCTGTCGGATGGATTGATTCCACGATCGCTGA
AACACATCTTCTCACTTTTAGATCAAGCCCCTATCGACGTGAAGACTGTCGTTCGTGCGTCGTACTGTGAAATCTACAATGAGCAAGTGTTCGACCTACT
TAATCCGGGATCCGGTGCATTGAACATGCGATGGAATGCGCGCGCCGGTTTCTACGTGCAGGACCTGCTTGTCGTGCGATGCGACTCGCTCTCTGATGTG
CTAGCTGTTGTTGCTGAAGGTCACCGAAATCGTCATGTGGCGTCACACAGTATGAATGCTGACTCAAGCCGCAGTCACTCATTGTTAACTGTCCATGTTG
ATCGCACGGAGGTACGCGACTCAGACGTCGGAAAGAGTCACGGTGTTACTCGATACGGGAAAATGAGCTTCGTGGATCTCGCTGGTAGTGAACGATTAAA
AGAAACAAAGTCCAGTAATACCGAGGAAACAAGCAATATCAATCGCAGTCTTCTAACGTTAGGAAAGGTTATCTCAGCGCTGGCATCGTCTTCTGGAGGA
GGAAGCGCCACTACAACGAGCAATGGTAATTTCATCCCATATCGCGACAGCAAGCTGACCAAACTACTAATGGATTCGCTTGGAGGTCAGAGTTTGACCC
TAATGATTGCATGTGTGTCTCCGTCAGCGACAGCATTAGAAGACACACTAAATACACTCCATTACGCTACCAGAGCCAAGAATATTCGCAACAAGCCAGC
GGTTCAAGTGGACCCCGTCGAGTTGGAGCTCAGCAATCTGCGCCATGAAAACCATGTACTTCGAGCAGAGAATCATGCACTGCGTCTTCGGCTACAACTA
GCAGGACCAATGTTAAATCAACACACTAGCCAGCCCCAACAACAGTCTAGCCTAGTATCCGTTACATCCAACTCGCGGTTACTTCCACTGAACAACACAT
CGCTATCCCCTCGTGGTGCAATGAAGCCGTCATTATCCTCTGTGTCACCTTCACGACGTAACCAGCTTCAGGTCCTTCAGGATGACCATGACAAGTTGAC
ACAACGGGCAGCCGTAGCGGAGCAACGCCTCAAGGAGATTGAAGCTGAGAACAGGACCCTCCGACAGCGTCAAAACGGAACGAGCAGTCCAAATAACGAG
ATAAGGCAATTGCGGGAGCAAGTGCAACAGCTGCAACAACGCGAGCAGGAGCTCATGCAGGCTTTGGTACGTGTGCTATACGTCAATTTTCACCCCTTTC
GACTTTAACCATGCTGTTCATGTTCATGTAAATGTTGTTGTACTAAGTAGTCTCGACGAAGTCGACGCGAAACGCATTGAATTTACCACTTCAACGTGTA
ATAAAATATGCTTACGCAGTACGTTTGGTGTGGTGTACATATTATATGTTAAGTACGCAAAGTAGTTTGGTCTCCATTCGGAGTCCATCAGCATGGCCAT
GGCGAAGTCCGATGCGTCGCGCTTGCGGAAGCCACTTCCGTGGCTCAAGAATCTGCAAGCTTCTCTGAGCAACGAGGAATCATCAGACTCGTCACAGCCG
ACAGAGGTGACACCCAAGAAGGTGGGGAAAACGTCAGTGAAGGCAGATGAGAAGGAGGTCAGGAGACGCAGCAAGAAAAAGCGACTGCGTCGGCACGAGG
GCAACAGCAGCGATGACGCTTCGTCTGGAGGGGATGACGACGCAAAGAAAAGGAAGCGCAGGTTGCTGAAAAAAGGCGTGAAGGCTCGACATAAACGATC
TATTGAGGAGTCAAAGAAGGCGAAGTGGCCTGTGGGATCACCAAGATCGAAGGCAGCAGCACTGAGGGGGCAGCGGAAGCAAAAGCTTCACGCCATGCGG
ATGACCTCTGGAGAACATGACAGAATGGCGGCTTTTAAACTTAAACGACTGGAGTCCGCTGAGACGCTCAGAGACAAGGACAGGAATCATATGCAGCCGG
TCCGAGCAGCGCGTGGTGCACAAAAGACTGCTGGTGCGGAAGCTGATGTGGAGGATGAAGGGGAGCCTCGACGACGTTCACGAGTGCGACCGACAGCTGA
CAAGGATACTACAGACAACGTTTCAAAGAGCAAACTACGCAGAGCTAGCATTTCGAAACAAGACAAGCCCAAGCAGATAGAACCCACTAGTCTCGCTGTG
GAGAAAATTTCAGCCTTGGTGAAAGATGGTGCAGGCGATAAAAATGAAGTGAATTCCCGCGCCTTGGCAAAGAGTAAACCTTCTGATCTAGGGAAGCGCG
ACGACGACAAAACAAAAGATTTGGCAGACGCCGTTATCGCAAAGACGCTCGAAGTCAAAGACGGAGATTCTGCTGCGGACATGCGAAGTACGACTACCGA
AATCGCCATGCAGGAAGGTAGCACTGGGGCCATGAAAGCGGAATTTTCTGAACTAGAAGCGATTAAAGGCGCCATGAAGGTGGAGCCTGAAGCCTCTGGG
GATGCTAAACGTGAACAATTATCCCACGAAAAGCCTGAAAGTGTAGACGCAGACTCAACTAAGATGGTTCCTTTTTCGACTTCCAATGAAACATCGGTTG
AACCTTCGGGACCTGGATCCAAACCGATGGAAACCGATCCACTCATTGACTCTGAAGGCACAGCTGAGCTGGTGAGAGATAAAGTTAAAGAAGAGGGGCA
AACAAAAACACCCGCGATTTCTGCATCGACAGTGAAAATGGAAAATGAGACGAAGCCTGACGACAAAAAGCTAGTGCTTGATGAGGTACCCATTCCTAGG
AAGGCGCCCAAACAAGACTCAGCTGCACCTCCTAGCCCGGGGTCATTCATAATCCCCAAACGGAAAATTGTGAAAACTGTCGTCGCTGGGCGTAATACCA
ATACTCAGGTGGAGCCAGCTGGTACCATAGAGGCCACAACATGTGATGTTAAGCGCTCGTTAGAAGCGCCTATGCCCGTTACTGTGTTGCCATTGGCGTC
TCCTCAATCGAGCCCAAACGTGCCAAATGATGAACCTACTCGTCCGCAGCGAAAGCGAACAAAAAATCCAGTGCCAGTGAAAAGGTCGTCGTTTTCAACA
CAAGATCGAGCTCTAATGCGCCTGTCCAGGAAGCGAAATTCCATCTTTATGGCAGGGACAGAACTGGCAGCTCAAGCTCCTGGCAATACGAGCAGCAAGA
CAGGGCCAGTGTCACGGATGATGGGGTATGAAGTGTATGATGTCGATGGGAAAATGCTACCTGATTTTATTCCTCGTTTAAGCTGCGCTACGAAACGTGA
AATGGCGTCGGACCGGGAATCATACGTGGCCTCGTTTTTTGGAGTATCGCGTACGGCTCCGAAAGCGAAAACAGATCCAAGTGCTGTCAACGAGGAATGT
GACGATACCGATCTTGATTCTCGAAAGATGAACTGTTACGAAGAGTTGTGCTTTGAGCGGCCTGAGGACAGAGAGTTTTACCAGCGGAAACTGTACGGCA
CAACGTTTGTGCCGCAGAATTTGCGCGGCTGGATGACGCTTATTGTCCGAAATGCGCGTTTTGAGCGTAAGTCCACGGGGATCCGCTTCAATCAGGATCG
AGATCGGGAAGAGTTCGCAGCTACACTGAGCCGGCGATATACATTTAAGAAGTCGATGCCACGGTGTGATATCCCTCGTGAGAACTGGCAGAAGCTAATG
AGCAATAAGCCAGCCACCGTGTACCTGCACTATTACAACCGCGAGGACGCTGAGCGGGCAGCACAAGTCTTTCGTGACGACCATGGACAACCTCTACAGA
TTCGATGGGAGTTAAAAGCTGGTGCGAGAATCAAAAGATGCTCTTCTCCGGCCATCCGGCCGAGGCCCCAACTTTCTCCACGTCGCTCTTGCTCCAGTGA
GCGGAGTGCGCCTGATTCATCCCCTCTTTCTTCGCATAATGGCAGCGCGCGTAACACTCCGGTGTGGCGACGTGAGCGTGACACGACTTCGAGAAGAGAT
GATCGGTATTCAAGATACGACCGTGGCGCATCGCCTGCACAACGGTCAAGGGAAGAGAGTCGAGAGAGGCGATATGGCCCGTCCTTGAGCGGAAACAAGC
GGTCGCATGGCTTGTTAGAGCGTAGATCTCGATCTCGCTCAAGATCTAAGTCATTCCACAATCAACACTATGAATCCTCTGGTCAAGTGAACAGAGCTGG
GTCAAGGGCTAGTGGATCAAGTAACCAGCACCCACGTATGACAGACAATCACGCAAGAATCGATGGTGGAAATGAAAGCGCTAGTAGTGCTGTTCACAGC
GATGTGGGCACGCCAGCGCAGAAGCGAACACGATTGTTACCTCGTCGATTTCCACCCAGTAGTCATGACAGGAGTGCAGGCAGAGGTAAGAACCAGGGTG
ACCTGGGAGGCAAGGAAGTCAAGAGCAGCTCAGTGGCAGCGTCGAATAATTCTGTGGGAAATTTGGATGGAGGTGACAACAACCGAGGAATGCCGCGTGC
TCGATCTCCACCCAGACGGTGGCGGGAGGAACCGAACAATCCAACGCCACGAGAAAGACGGAATACCTTCACGGTTGATTCACGAGATCGCTCAAAGGGC
CCGCCTGCTGGACAACACCGTTCTAATCAGCAGCCACACAATCGTGATCCAGTTCAGGGACGACCTCGATCATGTTCGCGCCCCAAGACTTCTTTGCCTG
CGCGTGATGGACATGGCGGTGACCGTGATGGTCGGAATAAGGAGCGAGTCGGCTCTCGAGAGTTTGGGCGAGGCGGTGGCTTTAATCGCAATGCTCGTGA
AAGGCGTATGCATTCCGATGGAGGACGCGAAGGACACAATGATCGCAGCGGAGGCGTGAACTCACGAGCACCCTAGAAAGCTGTTTATTACGAAAGCATG
TGCACTTGTACTTCATTCAAGCATCACGTTCTCTCTCCTACCCTTCGCTTATCTCCGCATCTAGCTCCTGACCTTTACGAAAGAGGAACTCTGCCAGGTA
ATCAATTGGGTCTGTGGGTTGCACCTTGACGACTTCCAGCATCCCTTCGGTCAGCGCAGGCAACACTGTGTCCATGAGGTACGTTCTTAGTGGTTTAGCG
CGTGTTTCAAGCAGCTCAGCCTCTTCACGTTGCAGGAGTTCAAGTCGTGCACGTTCCCGAGCGATTTTTGCCTGCTGGACGGCCTCATCTTGGGCATCCT
GCTCACGTGTGCGTTGCGCAGCACGAAGTTCAGCTTCACGAGCTTGTTTCTCCGCAGCACGGAGCTGTTCGCGCACTTCTGCCCCCGTGGGATGAAAATT
CCGTGGTGCTCGACCACCTTGCTCCATGTAGCGCTGGATGGGAACAACAAAGGCCTCATCCTCGCGGTATCCGTGCTCGTCCCGCAGAGTCAGCTCCAGA
ACTTCCACGCCTTCAACAGGGACCGCCTTGGCATCAGTTGGCTTCTTCGGCTTCTCGAAGAATGCCTCCAGGGCTTCAATGTTGGATTCAAACTCGTCGA
AACGCCGAGCGAATGCGTCTTGGGTGTTCTCCGTGCGCTCGGCCTCAGCTTCTGACAGCGCTTGTGCACGTATCTCAAGCAGTGCTCGAGGAGCTTGTAG
CACGATCACTCGGTTCGGTACTTCGACATTCTGTCGGGGCTTCAGACGCGCCAGCAGTGCTTCAATATCCACCGCGGGAGCGGCAGCTACCCCATTAGCA
TTCTCGTCTCCATTTGCTGGTTCACCACCGTCTGCTCCATCAATTGGGTTGCTGGCTCCACCATCTCCAGACTCATTAGAATTACCTTCTTCGTCAGCGT
TGCTGTCTTTATTGGGCTCCTGCATGAAGATTTGTTTTGCCTGAGTTGCCGAGATTGGTAGCCCGTCTAGCACGTATCCCTGGTTACGGCATGCAGCACT
CCGAAGCTTCCAGCGTACCAACGCTATCAACGCGCTCTGTGGAAGTTGAGTCGTGTTTTCGCCGGAGCTACCAGCAGTTGGAACCCATTGCTGTAACTCT
TCTCGCAATTTGTGTGTCTCCTCGTCTTGACGTTCAAGTTGGGTGGCGACATTGGTCTTCTCGGATGCAAAAAGCTCGTGCAGTAGTGTCGATGGAGACA
GATATGGCAGATAATAATCCCTCGCAAGCTTCCGGCTTAGCGAAGTTTTACCCGCTCGAGGTGCGCTGAGAATGACGGTGCGCAGTGGATGCAGATCCAT
GGCATGAATGAAGTCGTCGACAAAGAAGGCCAGATTTCCTAGTAGTCCTCGTGAATAGTGGCGCCATTCTTCTGGAGCCACCAGCGTATGCATCGCCCCA
GCGGATGTATCGAAGCGCAAGTGGACCTGAAGTGGTGTCACAAGCTCCTCCTCTTCGTCCAATAGTAGTGCGTCTGCTTCAGCGTCGTCAGCATTAGCCG
AGTCGTCACGGTCGCGTAGACGCCCTGAGGCAAGCAATGTGCTAACCCCGCGACACACGTCACGAAGCGTTGTGCTACCACTAACTCTATCCACTGCAAG
CAGATATTTTTTGGGGGACGGTAACGGTGAGGCTGCCACACGGAAAACTAGCAGCGCCAGATCATAGAGACTGATCATGGGCAGCAGATTGCGACCTTGA
CTGGTAGGCTGAGCTGATGTGGCGAGACTTGGCACCAGTAGTGGCTGATCCGGATGCAACCATGCCTCGCGAAAGATCAATTGCAGTTGGGATTGAGCAC
CGCCATAAATTAGTCCTGCTCCGACGATGCAGGTTTCAAGTTCTCCGGTTCGATGCGCACTCAAGATCAGCGTTTCAACAGTTTTGAGGTCTGTATACTT
GCGTGCAGGGCGTCGCGACTTGAAGTCGTCCTCAACATGTCCGGAATCGGTCCCTGAAGCTGCAAACGGCGAATTTTTGCTCCACGAGAGCACAGAAGAC
ACTGCAATAAAGCGTTTGACGCTTTCGCCACCCTCGTCGTCTTTTGCTTCGTCGTCACCTTTATTTGCATCACGCTTCTCGAAGACCTTCAGTGTCTCCA
TGGCCAGCTTCGGATCGGCTACCAGCGAGGTGACCACTACTACGTCGGCATGCTGCACAAGTCGACGCCATGCTACCGTATCGGTTTGTAGTGCGACAGG
CTCTTTGACAGCTCCAGCGACGTCACTACCCGGATGGTTCTGCAATTGGCGTTTGATCGCGGTCATTTCGGATTTCCCACCCCGGGCGGCAGTACCGATG
ACTTCAAGACCAGCATCTTGACAATTCCGTGCCAACTCCGTCGATAAGGACGAGCCCAAGTCCGTGATGAAAACGCGCATTCTTACCACCAGTGCGTCGT
TGCAGCTTGACGATATCAAGTGGGTTTTGAGGTGTTGCTGTTACAAGCGAGAGTCCCTCGTGGTGGCGGTTGCAGGCATTCGGATATTTTTGCGTTGATG
GCGTCCGCTACACGTTGCATATAATAGGATAGAAACGCAAGAAAATAGTGCTCGGTGACTCAAGAGTTCTAAGACATCACGCCACGTTGTCGGATGTACA
TGCAGTTGTCGATATAGTAAGGTTAATTCACACCGGTGACAATGAAAAACGAGCTCGCGCCGCTTTCCACGAACCCGAAGACCATCTCGTCTTCATCACA
TCCACGACAGCGCAATGGTACGTCGAGGTATTTTATTGCATGAATGAATCCTGATCTATTTACTAGTTTTTTTTTCTTTCCAGTCGGTATTCTCGAAGTA
AAAATGAAGCATCGACTACAAGAAGACCAGAAGGCTGTAGCGGTGGGAGTTTTGTCTCGGTCAGGTAACCCACAGCGCCATCACTCCAAGAAGCCGCAGC
GACTACCAAAGCTTTCTTCTAAATCGGAGCCAACACTCGACACACGACCGATTTCTTTCGCGACGGAAAGAGGCCATGTCATGTCAGACCTTCATCTTCC
ATCGCCTACACGCTCGGTCATTGATCGTCACGTGCAAATTACTAAACACACCACTCAACTGGCTCAAGAGGCGCTCCCACCAATAGCAGGAGCTTTCAAG
AAGCGTGGGGTGCCTGCTTCAAAGTTCCCCCAGGCCTACGCACGCAACGAGTTGCCTATCATGATCGAAGGTGGCAAGGGTGGCGGGAAGTCTGGGTTAC
GTTGGACAGCTCCAATGGAAGATTTGGATTTTAATAAGTACTTCCCCTTGTTTGTGGACGGCATGCGCGAGAAAACGTTCCCATTCAGCTTTTTGGCCCG
TGAAGGTGCCTTTCAGCTAGCTGCTTTTGCCCAGCGATACCCTAACAAACTCATCGACTGTTTGCACCGTGTGATTCCGGCACTTCGCACAAACTTGGAG
ACCCGTGACGATGGAGCATTGCGAGATGCGCTGCTATTGTTACAACAGATCACGCAGACGGCAGGTGTGGGCCCGTTGCTGGTACCTTATTACCGGCAAA
TGCTGCCAATTCTGAACCTTTTCAAAAGCAAACGACGAAATCTCGGGGATGAGATCGATTTTCGACAGCAACGCTCACAAGATCTCGGCGAGGTGATCAT
GGAAACGCTTGAGATGCTTGAACGAACAGGAGGCGATGACGCGTTTATCAACATAAAGTATATGGTTCCAACGTACGAAAGTGCGTTAAGCTGACAGCGA
TAAACTACTAAAACACGGTAGAATTAGTTTTCTTTCGGTAAGCTTTTATAATGACGCGCCCATCACATGCTCTCGTCTTCTACAGGTACTGGTACAAGTG
TTGGCTGCAATTTGTCAAGTTCAGCTTGGTGACGTTTGTGGATGCGCTGAATCTCGTCTTCGCATTCTTTTACCTTTTCACGCAACTCCTGTACATGAGC
ACGCAGCTTCTCAGTTTCTTCCGCATGCTGACGCTCGCGCTTTTTACGTGCAGAGGGTAGATCCTCGCGCTGTATGCGAGACATACTTTGATACTGAGCA
CGGATCTGCTGTAACTGCTCCCGCATTTCGTTGCCGATTTCTTCGCGAATACGAACCTCCATCTGCATCTTTTCAGCTTGGATCTGTGTTAATTGCTGTC
GGAGTTCCTCATTCTCCAGCTCCAGTTTGGCCTGTACATGTATTCCATAATTTCTGTAAGCAACACCATCGACAATAGACAAAAGACTGACTACGTACCC
AATGCAGATTTCTCTCGGCGACCTCTCTTTGTGACTCCATTGGTGACGTCGCTACTTCTGCTGTTGTCGGCTTCGCTACTGGAGCTGCGAGCGAGCGATG
CCGACGGCGAGCAGAGTCACTCTTTCGACGCTTGACCTTAGGCCTGGGCGGTGATGAAGCAGTAGCTGCTACCCCTCGATCCACGGGTGCTTTCGATGCT
TGTGTTTCGAGTGCTTCCATCAACTGCCGCTTTCTCTTCTTCAATCGACCATCCAGGTCGTAAAACGTAGCTGTCGGAGCAGCTTTCCTAGGGATGGATG
TTCGTGTCCTCACTAACTCCCGTGCAACGGCGCTGTATTTCAAAGTACGCAAAGTCTCGTCAAACTCATGGCTGGATGGATTCACTGCCACAATCATCAC
CAGGGGACCGTGATCGTTGCCCACAAGATTCTCCTGAAAAAGTCGCGCTAGCTTGGACTCACGGAACGGGACCATCTTTTGTAAGCTCGGCGGGTGTTGC
TGGTTCCACCTCAAAGTCTCCAGACAACGCATCAGGTTCATCAACGAACCATTAATCTTGCTGGCCTCCTGCATACGTAGCCCCGTTGCACCGCTCTTGG
AGCCTCGTTCAGACCCTGCCAGATCAACGATCGACACCTTACTGCGCAGCTCCGAAGAGAAGCGCGATGTCTGGTGATACAAATGAAGCGTGAAGACGCA
GTGACTACGACTTGAGTCCGAGTTGTAGTTGGTCTCGGCCACCTGCTTATGTCGTCGACCCATTTCCAGCAGCTCCAGACCTTCCTCCAGCGTTTTAATG
GGTTTCTCTACAGCTCCTCGGACCTGAATTTTGCCGTCGCAGTCCTGTACACGTAGCGCTCTTCTCTTCCGAATTGCAGGTGACAACAAGTCGAACACGT
TCTCGTTGTAGATCTCAAGGTATGTGGCTGTCACTTTCGTTATCAGTTGTTTGTCGCCCTCCTTGCGCTTGGGTAGCTCGTCCATCACGTACTGTAATGC
CTGTGGCAGCACACCGGGCGCTTCACTCGATCCACTGATCGTATACGTCTTGCCTGAATTGGTTACTCCGTAGGCAAAGACGAGGCCGCTCTTTCCGTCG
AAGGCCGCGTCCAGCACGGGTCTCGTAGTGGCCTCAAACAGCTCCGTCTGCTGTGTCTCTTGACGGAAAATGCGCGAGAATTGGAAGCTCGTGGCCGTCC
CAGTCGAGCGATAGGATTGCGACGTCTTAGGCGGTTGAGCCAGTAGCGACACGTCCGACAACACCCGAAAACAGTCGGGCTCCGTCTCGTTAGAGGCCGC
TTCGAGCGGTCTGAGACGAATAACGATCTGCACCTTGTTGGTATCCATCTTGGCCTCCTGCTGCTGTTCCAGCTCCTGCTCTGTGCCGTCGCCTTGCTGT
TCCTCTTCTTCTACCTCTTGTTCGTCCATGATAGCACCGCTGAAGCTGAGTTTGCGTACAATGGTACCCACTTCTTTTGCGGCGAGCGACGGTGTATCAC
TCGTTCTAGTGCTGCCGTTGTGCGCCTGGCTAACGTCCTCCCCAGACGCAGCCATTATAAAGTACAACGAGAAAGTGCGCGAATATTCAAATTGAGGATT
CATAACATGGTACTTTAACTCGATATAGTGACACGTCAGTGAAATCTTAAGGGGGTCAAGAGCTGACAGAGACAAAATGACGCTGTCAAGAACGCACACG
CTGCTATTCGTGCTTGCCACGACGGTGCTTCTTGTGACCTTCGCCTCCGCCGACCCTCGTGAGGTGGAGAACGCTGAGTACGTCTATGTTGAACCCTGCA
ACTACTGTCCTCGTAGCTTTACTGTAGCCGTAGATCTGACTGCCCATTCATGTGTCTTTAGACTCAAGGAGGAGTTTGGCGACGATTTCGAGGACGAGCG
CTCCATCCCCGCGCTCGGTGAGCTCGAGCAGCGTCTCAAGTTCGATTTGGAACACCAACTGGCTGCTGGTGCGCCCTTCACACCACGCGGCGTTGTGGAG
ATCGTGGCCAGCGCTTCGTCCCCCAAGCCCAAGGTCTCGTTCTCGGCATTACCGACGCTGAGCGCCGACGACGTCGAGAAGATGGAGACACTGCTGCACC
AAGATCGCCACTACACTGTTCGTGCCAAGGCGGACCCGGCCGACCCGGAATCGCCCTACGTCATGACATCCGTGCCCATGTGTATGCTGGCCGCCATGCG
TCTACGCGAGGACTTTGCCTTTCACCTCTCGGATAATGGCAAGCTCGTGGCCATCGAGTACCTCACACCGTACCTGGATAGCGATGCCTGTGCTGAGTTC
CAGTCCCGTAGCCTCAGGGACGTGCGCTTCGGACCGTTCGGCACAGTTTTGAAGACGCAGGCTGGACCATCGTAAGTGATCATGACATTCTAGTGGGCAT
ACCGATCTGGCTCTGACTCGTGCGCTTGTTTTGATAACGTAGACCTCCGAAGAACATTGTGGTCAAGCGCGACCGTGCTCCACAAGGCGTCAAACCGGTG
AAGAGCGAGGATGGCAACGACGAACCCGAAGAGGAAAACCAATCCTTCCTTCGCAGATACGTACGTGCATCAGAAGTCTGTGTCTAGCTAGTATTGTCTG
CTGATCTCAGAAACTCACATCCATTTTGTGTTTGCTTTCTGTAGTGGTACATTATTTTGCCTATCGTTGTCATGAGCCTGTTCGGTGGCGATGGAGGCGC
ACCTCCGGCCGGCGGAGCCGGTGGTGCCCCTGCTGCTGGTGGTGGAAGACGACGATAGATCACTGGACGAGGAACAGAACATGCATGCATTGTGCAGCTT
CAGCTCGTTCCACCCACGGTCAGTAAGGTGTCACAGGTAGCAGAACAGAATCTACATTCCAGACTGATGGTTGATATCTCTGAAGCCTTGCACTTATCAT
TATACGATCAAGCTGGTATGCTCCTCTTCACTCCCTTTTTCCTTCTTCCTCAGCACAGTTCCAGGAGCTGGTGGCCACTCGTGGTTCGTCACCAATCGCC
CCCACAGTGTGTGGTCTCCCGTGGACACCACCACAGCCACAGCCGTTCCTTGCAGAACACTCACCGTCATGGGGATAATATTACCACAGTGCAAAGGATC
CTGCTGAATATGCGGCGGTGGCGTGTCGGTCGTGACGTGTTTCCTGGTGCCTCCCTGTCCGGCTTCCTCGTCTTCTCCGTCGTCGCCCATCAACGTCGTT
TGGTCCACTACGCAATCGTTCGAGCACTCGATGACGCGCAGATCAGCTCCTGCCACATCCCCAGCCTTGAGCTCCACCACGTCTCCGTACACAAGACTCA
TGGCGTCCATCCGCATTCGTCGAGTGGCCGGCTGACCCTGCCCTGCAGCAACTCGACGACGCACCGTCGCCTCACGTGGTAGCGCCTCTTGATATGCTTG
CATGGAGGCTGTGCGCATGAGGCACGGCAGTAAACAGCAGACCCAAGACGGGCAGTTCACAGGCGGGGTCACCCGGTTCACACCGTAGAGCTCGCGTCGC
GTCATGGCGTCGTCTCGAGAGAGTCCGAGGGCGGGGTCCACACCCACCTCCGCCACAAAGTCTGCCACATTCGCAGGTCGTTGGTAGTCCTAACACAGGA
GGCAACAGAAAGAAGAGGGTCAGGTGAGTAAAAAGCACGCGTGGTAACGGAGAGCTTCAGTAGATCGGACACCTCGAGCTCTTTCATAGTTCAGATCCGT
TTTGCAATCTGATTTTTGTCAAATCTTATTAGGATTATTAACACTGAACAAAGAAATATACTACAGTAGTACTAAATTGAAGCAAACGGTCTGAAAAACA
ACACAGCTCAACCTATACCAGATTCTATAGCAGTCACCATTATATTTCTTAATTGCACGCTGCAATACATGCAAACTCGTCGACAACAACATACAACTGC
TTCTTAAAGGTCCTGATGCTGCTTGAAGCTGTTGGTGGTGGCTCACCTCGTTCACTTCTCCGATCGAAGCTTGCGGTACGCCTTCTGAGAGGTGGAAGTC
GTGCCGGCCTTTGCACCAGCGTTCGCGTTCGCATTCGCAGAGGCGCTTGCAGTAGCACTGGCCGACGCACCACCCGTGCCGGTCGACGTCTTCGCAGTAC
TGGCTCCACCATCGCTCGTCACGGTCACAGACTTGCTCGCGCCGGTTCCAGCACTCACATCGACACCGTCGTTAACAACGGTGGTAGGTGCACCGACATG
GACACCGTTCACTCCAACAGCAGGAGAAGCACCCACACCAACACTAGCGACACCCGGAACGCCCACACCAACACCAACGCCATTCACGCCAACTCCAACG
CCGTCTACTCCCACGACACCAGGTACGCCCACACCAACGCTAGCAACGCCCGGAACGCCGACACTAACGCCTGGACCGACGTATCCGGGGGCACCCACTC
CGACGCTAGCCACACCTGGAACACCCACTCCGACACCGACGCCAGGGACACCGAGTAGTCCGAACGTCTCGGCCACTTGCTGTTCGGCGTGTGCACCACT
TGAGAGAGCCACAACGGCGATGCAGAGAGCGAAGATCTTGTTGTTGCTAAACATGGTTGTTGAAGAGGAGGCTTGGTCAAATGAAAAGAGTAGAGGTCTT
GCTCTTGGGGAAGTTGGTTCGAGTGGATGAGCTCGAAGGAGTGAAATTGAGAATGGAGGTGAGAGCGGCATGGGCAAGGCTCGAGTGGTTTGCGTGAGGC
AAGAGTTATGAGTAGCCGATGGAAAAGCATGGGCGGTGTAACTGGCAGCTTAAGCGATCTTCTTGTGACGATACGGAGTCTCATGTGTGTAATTGATAGG
TGATAGAGTGAGTCTCTGGAGTCATGGGGTCCAGTACGGAGGGCACCTGTTGTACACATACACGATCATTTTGGTTGTAGCAGCGCGCTCGTTATCCAGA
ACGACAAATTTCTTGATCTCTACATCTTCTTATCCACGTTCCTTGACTTCCATCAATTCAGAAACCAGCCGAGCATTTACGGGCACCATACTGATCGATC
CTGTTACATGAAAATGTGAGTCCAAGTATTGCAGTTCTTATTCAACCGCTTTTATACTGTGTATTGTATGCCCTATGTTGAAGTTGACTAGTGACATGGA
GTATGCGCCTGTTCGAATTGACACTACGATTTGCATCTCGGCTCGTGGCCCCTAGACGATCGCTGCAACCTCTGTTTCAAACCATGTCCTATACTGACTC
AGCACCGCCAAGATACGGAAAAGGTTGGAAATCTCTTTGTTCAATCCATGCAACGCTGGTATTACCAGACCATTCGTATGGATCCCTCTGAGATTCATCA
TGAAGAATTCTCCCTGAACAACTTCACAGCATTTGACTGGTCCCCCACTCAAACCTTCCTTGCAGCAACTCACTCATACATCATTCTCAAATTCACTCCT
TCGAGCTCATCCACTCGAACCAACTTCCCCAAGAGCAAGACCTCTACTCTTTTCATTTGACCAAGCCTCCTCTTCAACAACCATGTTCAGCAACAACAAG
ATCTTCGCTCTCTGCATCGCCGCTGTGGCTCTCTCAAGTGGTGCACACGCCGAACAGCAAGTGGCCGAGACGTTCGGACTACTCGGTGTCCCTGGCGTCG
GTGTCGGAGTGGGTGTTCCAGGTGTGGCTAGCGTCGGAGTGGGTGCCCCCGGATACGTCGGTCCAGGCGTTAGTGTCGGCGTTCCGGGCGTTGCTAGCGT
TGGTGTGGGCGTACCTGGTGTCGTGGGAGTAAACGGCGTTGGAGTTGGCGTGAATGGCGTTGGTGTTGGTGTGGGCGTTCCGGGTGTCGCTAGCGTTGGT
GTGGGTGCTGCTCCTGCTGTTGGAGTGAACGGTGTCCATGTCGGTGCACCTACCACCGTTGTTAACGACGGTGTCGATGTGAGTGCTGGAACCGGCACAA
GCAAGACTGTGACCGTGACGAGCGATGGTGGAGCCAGTACTGCGAAGACGTCGACCGGCACGGGTGGTGCGTCGGCCAGTGCTACTGCAAGCGCCTCTGC
GAATGCGAACGCGAACGCTGGTGCAAAGGCCGGCACGACTTCCACCTCTCAGAAGGCGTACCGCAAGCTTCGATCGGAGAAGTGAACGAGGTGAGCCACC
ACCAAAAAAAAAAAGCCACCACCAACAGCTTCAAGCAGTACGTGTAGACAACAGCATGCTATGTATCGGTGTCGTTAGTAGTTGCGTTTGCGTGTACAAC
AATAAAATACGTAGTTCTTTTGAAGGCTGAAGCAAAACTTGTTGGAATTTTATTTTTTTTCTTCAGATATCCCTAGTGCAGTTTCCCATTGCGATCTAAA
GCGAAATTCTACAGGCGACCTTTATAACGAGCCCGGTGGATTCTGCTGGATGCTGCCGTCTCTATTTATACGAAGTACTTGTCTAAAAACTTTACGATCG
CCATGTAAGGCGAACAAAAAGTGGATATCGAACGGTTTGTTGGCCAGATTCCTAGTCGTGGAGATGATCAATCTCGAATGAGACATCCGTATCCATGAAT
CTGGGTACAACATTGGTTTGGTATTGGTATCATCAGGCCAGGAATCGTACTAAAACGAAAACGTCATGGTGTTGCGGCTGACGAGACAACCAGCGTTCTG
GAATTGGTGCGAAAAAAACTATCGAGCGCCGCTCGCCAACTACTCCGTTGTCAACGAATTGCAATTCCGAGTCGGGCGAGATGGCGAAGTTGAATACCAA
TTAGTTGGGGATATGGCATCAATGCCACTTGGTATAGTCTATTGTGAATCAGACCTGCGCCGGTAGAGATAAAATACAAAACACAGGAACTCGAAACTCA
CGCGCACCTTGTTCACCTTCTTTCTAGATCTTCAGGTCGGATGTGGCACTTCTAGCGCTTACATAAAGTCATCGTAGTCATCGTACGTGTCTTCGTAGCC
AGCATACCCCTTACCACCAGCACCACCGTTGCCAACGTTACGCTCGACATTAGCGTAGCCCTGCTTGCCCGTCTGCTTCTTCTTCTTGCCTTTAGGCTTG
GCTGCCGCAATCTTCTCATTCTTAATGACATTGACGATTGTTGTGATCTCCTTCATGTCATCAGCCGTCAGGTTCACCGACGCCTTCGTGAGAATCACCT
TAATACACTCAAGAGCATACTTGGAATTGGACGTAGCCAACCGGGACGACACCACGTCACCCAGGTGCTCGTGGTCGGCGAGTGACAGCAGACGCATGGC
TGAGATGGCACTATCCGCGTCATCAGCAGTGCCGATCGCGGGCTTGGGCGGTGCGCCGGCAAAGGCGTCGATGGCCATCTCGAAGTCCGCCTCCTCGATA
GAGGCCTTCTCGCGGGCTCGACGCTGCTCATCGGTCTCCTCCGCCTGGGCGGCAAGACGTGCCTTGGTGAGGGCGATCTCCATCTTCTGCTTCTCCTCGA
TCTCCTTGAGCTTCATCTTCTTAAGCTGTTTGGGCTTGAGCGGGCCCTTGGGGGCGGCCGGCTCGGGCTTGGCGGCCACTACCGGCTCCTCCTCTTCTTC
CTCGTCGTCCCAGTTGGCGGCGACCTTCTGCGTCTCCGTCACCGTCGGCACTTCGAACTCGTCGTCATCTGCAACAGTCAAACAAGGTGGATTGTGAGCG
ATTCAGAGCGAGTAAGACCATACATAGCACTGCGTTGCGCGCGCGAGACGCGGCGCTAGCAAGCGGTACTAGTAGATGCAAATATAAGTTGCAACACGCA
CCCCAGGAGTCCATCTTGGCTGGCTGCTGTATTCAATTTGCTTGCGCTTTGGTTGGCGTTTCCGCTTCTCTCCCTGTTCGATTATTGGCCTCCAGACAAG
GTGCTGACGCATGCTCATATACAAACCTAAATTAGAGCACAAATAGCCTAATTTAGCGTTTTCCACATCAACAACTTATATCGTAATCCCCCTGTTTATT
CCTTGCGAGTCTTAGGATATCTGTGCTTTTTCCTCACCGCAAGTCGATACATAGCTCATTAGAGCATCATGGTCTCAACCAGCGCCATGTTCCGCAAGGC
TCCGCGCCGCGTCAGCCTCCTCAGGGCGCAGCAGCGTCGCCGATTCTCCCAGCAGCAGCAACAACAGCAGCAGCAGTCTAGCAATGGCGCTGCACCCTCG
GGCAGCATCTTCTCTGGCAGCTGGAAGATCCCTGCCACCATGGGCTTTGCTCTCATCGGATTTTTGCAGTGGCAGCACCTGAACCATCCGACGGATGAGG
AGCGCAAGACGCACCCAGCGCAAGCTTTGCGGCGTCTGCCTGGCGCACACACGGCGTTTGAGGACACGATGGCCACTGAGCGCCAGCTACAGTCGCTCAA
GCTCTTCCCGTACCGAGCTGCAAGTCGCCTCTGGGGTGAAGTGCACGACAAGGAGCTGTACGATCACACCTACTTTTGCACACATCTGCAGCAGATCCTC
ATACTTTTGTGCTTTATGACTGAATGGCAGGCCGTTATGGATGCGCGAACCCGTCTATAAGGCGTGGACTGCCGTCTTCAACTGTAAACTGGACGAGATG
AAGTACCCGTTGCAAGACTACGCCAACCTCGGCGAATTCTTCTCGCGCCCATTGAAGGAAGGCGCCCGGCCATTCGACACGGCTCCTGGTCATCTCGCCA
GTCCGGTGGACGGCACAGTGGCCTCTATCGGTGTGGTGGACGACTCGACCAACATACCAACACTGGAGCAAATCAAGGGTGCGCGCTACCGACTCGACGA
GTTCCTCGGCGATCTCCCCTCGTTCTTTACTAAAAACCCGTCTGCTTCTAAGGGCAAGAAAATGTTCCACTGTGTTCTGTACCTAGCCCCTGGCGATTAC
CATCGCATCCACGCTCCGGTGAACTGGCAGGTCGAGGAGCGCCGTCACTTCCCTGGAAACCTCTTCCCTGTCAACCAAACCGCTGCACGACTGATTCCGA
GTCTCTTCGTGGAAAACGAGCGTGTTGCACTGCTGGGTGAATGGGAGCACGGCTTCTTCTCACTTACTGCGGTTGGCGCCACAAACGTGGGTTCCATTGT
CATCACGAAGGAACCAGAATTCCGCACCAATACTGCCGCGCAAGACCCACTAGTGGGCCAGTGCATTACGAAGAACTACGGTGGCAAGGTGGACACAACT
CGTGGCGAGGAGATGGCACAGTTTAAGGTGCGATGGTTTTATAGTTGCAGAGGTTGCGATACGCTAACGAACTCTTGTTGCGCGTACCACGCAGCTGGGC
TCCACAGTCGTACTGGTTTTTGAGGCTCCTGAGTCGTTCCAGTTTACTATTAAACCGGGCGACAAGGTGAGTTATTGACGCTGTTCTTGGCTTGCAACAC
GGTTATTAACAGTAACTTGTGCATGTAATCACGCAGTTGATTTTGGGGAAATGCATCGGCAAAGTGGAGTAAATATCCACACCGACAACCTGCTGTGTTG
CTGTTGATGTCCAAATGCAAAGTCAACTCGATGAACTCGTTAATGCGGTTTACCGCTTCTCAATTAGAGCAGCAATTTATGCCTGCGTGTGGCAGTTTGG
ATACCTAAGCTGCATTACAGCATTTAATGCCCTGCTTATCCAAGGATCATCACTTGAGCGCTTTTCACCCACTCGACCGTCTAGACGGACTTGCAACGAG
GTCAGATACGACAGCCAGGGAATCAATCCCCGCGACCTCCCCAGGCTCGGCAACTTGGCCATAGGCGTGATCCTGGGAAGCAATCACCACGACTTCCCCA
GCCGCGGCAGCTAGGCCATAGTCGTGATCCTGGATAGCACCCAGTGCCACGCCGGTTCTCACCATCTTCCGTCGCAAGGGCTTCATCCGCATCATCTTGC
CACCAGGTGTGGCTTTCATCAATCACTGCCTCAGCATCGTCGGGTACCACCAACTCCGAGAGTCTAGTAGACTGCTCATCATCCGAGAGGCGACGCAAAT
GCGTGTCTACCAAAGCAACACGTTTCGTCATCACGAGGTTCAGTGTATAAGTCATCATTGAGAAGTTACATCACATCTTCCACTACCTTTCGTTTCCAGC
CCGTTGGTGAAAAGCTCAACCAAGGCAGCTCCAATCGTAACGACCAGAAGAATCAAACCCTTCATTACGATGTCGATTACCTGGTACTCAAACACCTTTA
CGGTTTATTGTCTCTCATCGTAGATAGCAGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN