Description :
From Genome Similarity Track
Location :
Scaffold_218:2987- 4128
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_218-snap-gene-0.11IP11380p

Sequence
1141 bases(100 bases per row)
TCAGGCTCAAGCAGAAGAAGGCGGCGAGCGCGAAGCGGCAGAACGAGCGCAGTGGGAAGCTTTTCGGCTCTCGCGGTGCCGATGAGCAAGACGACAAGTC
TGGCGTGGACCCGAACTCGGAGCGCGCCGAGCTCCCAGACCAGCTCAAGTTCGACTTCCTGCTGCGGCCGCCGCCCAAGGTCGAGCTCTCGAGCGCACCG
ACCAAGAAGGTCGACCCGGACTCGCGCAAGGCGCGGCTCTCACGGCGCATGCAGGAGATCGCGCGGCCTGGCAAAAAGGGCAAGCGCTCCGTGTCGCTTA
GCATCGAGGGGAGATAAGCGGCTGGGCTCACCGCTTCGGATGAGGATAACTGCATGATCAAATTGGTAATGTGACGCTCCATTGAACCAAACTATACTGA
CCTTGTCTGGTTTCGGCCAAGCGGTCGCTCTGCCTTTAACGGGAATAGCCGCGCCGTTATGTCCAAGGCACCGGTGGGGTCGTGACTCGGTTGCTGGTCG
CCATGGTGAGCAAGGACACGAGAGCCGTGCCTGGTGGCCATGACGCCGGTCACGACGCCGGTCACGACGCCAGTCACGACGCGGTCGACAACCAAGGTCG
GATCTCGAGCGACCTAGACGAGATCGCACTGGGAAAGCCCCTGCCGTCGCCTTCGAGCCATGAGGCGGCGCTCGTGCGCGAGCTCAAAGCGCTCGAGCTG
CGCTTCTTCCGCACGAGGCTGCAGCTCGACAAGACTCGCGAGCAGGTGAGACTCGCGTGACGAGAGCAACTCCCGAACTGTGTGTTGACTCGTCATTACG
GCCAGAACCATCGCCTCCGCCGCGATGCCCGCGTGGCGACCGCCACGACCGCCAAGTCGGAGCGCGAGGCCTTCAAGCTCCGCCACCTGGTGGACCGCCT
CCAGGTCGAGCGGAAGCAGCTCGAGCTGCAGGCGATTACCAACCGCGACTACGCCACCAAGATGGAGCTGCGCTTCTTCCGCGGCTCTCGCGCGCAGGTA
CCGTCTCGATCGTCGACTCCTCCAGCCAATTGTATGGTCAGTCTCACTCTTTGTCCCTCCATTCAGTCCTTGATGCAGAGCCACCTGCAGCTGCAGCAGC
AGCTCGAGCAACACAAGGCCGCGCTGCACGAGGCACAGACC