Description :
From Genome Similarity Track
Location :
Scaffold_782:2985- 4160
Transcript NameFunction/comments
Phyke_g11229hypothetical protein PHYSODRAFT_498916

Sequence
1175 bases(100 bases per row)
TCGAAACCGGCGTTTGATCTAATGGCatacagcagcttcttgcgcaTGGCTTCTTTGTTGGAGTACGCTGGCAGTTTGAGTAGATTCATACACGTCGCAC
TGGATGGCAATCggtcgtcgtcttcgacgCGCACTTGGTGGATGCAGATCTGCGGCACCAACCGAGAGAACCCCAGTAGCGGCTGCCGAGAGCAACTTGT
GATGAACTTCAGCAGAGCCGCACGATCCTCAGGCGCGAATTCGTTCACGATCTCCCAAAACCACTGGATGATGCGCTGGGACGGGTGGTAGCCGCCTCCG
TAGACAgtatgctgctgccagtcgTGTGCGTCAATATTCGTGGCTGAACCTCCGAtgagcatctgcagctcggcTGGGGCGAACATCTGAATCCAAGTGC
CTGGGATTAAATCTCGGAAGCCCTTGAGAAATGCCGTGCTCTCCATAGATGACAGCACATTCAACTTGTAGTTGGCCATCAAATGGATGTATCGGATTCG
GTTCTCGCTTGTCACGGGGATGTTAGCTCCATCAGGCACAAGATTGCGCGTCGCCACCTCGCCGAACTCCATTTCGCTCACACTAAATGTAAGCGCTAGG
TCTTCCACGTTGCCGTCGTAATGTTTGAGGCGCATCAACGACTTGTACAGCTCCGGGTCCAGCGAGTGCAGATCGTCAATGTAGTTGAACTTGCCCAGAA
GTTTATTCAGGAAGAACGCCGCAAACTGAGGCTCCACGAGGATATTTTCATACACGGCCTTCCCTAAAACACGACCGAGGAAGCGATAGCGGTCTAACGC
CTCCTTGCGAGTGTCTACAATGTATCGCGCTCCTGGGTTCGGATACAAGAGCTGATCATCCGTCGCCAAAAAAAAGCCGTACTCGGGCGAGAAGGCGCTC
TTCGTCAGGGTGTCCACATATTCCTTGAACACGCCACCGCCGTCAATGCCAGCCTCTTCCAACCCTTGTTCATTGATAAATGTCACTTTGATGCGAGACT
TGAGGGCCGCAGGCGACATTTTATCGCACAGTTCTTGGAAAAATTCGAAGCTGTTGTCTACGATTTCGTCGCGCTTGATGCGCACCTGTAACGCACGCAA
AAACTCGTCGCGGATTCCACCACCCAGCTGCGCTTTTTCGTCCTCCAGTAGCTTTTGGAAAAGTTGCACGCGCTC