Description :
From Genome Similarity Track
Location :
Scaffold_51:29849- 31080
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10208methyltransferase-like protein 23 isoform 2
Sappa_CBS223.65SPRG_10209PREDICTED: uncharacterized protein LOC101658911

Sequence
1231 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGGTGTCGTCGGTGTCGTCGGTGTCGTTCGGTGTCGCTCGGTTTTTCGGTTCGCCAATG
CTCGGTCGAGTACGTGCCCCGCCCCGGTATCTCGTCGGTCGTGCTTGTAGTCCAAGGGTGTCGGTCGCGGTCGTCGGTGTCGTCGGTCGGCGCAACCGTT
GGTAGTCCTGAACATACATATTTTTTCCCAACCGAAGGGAGGCCACGTTGTCGTCGTGGTTGGGCTTTTTACCAAGAGCCTCCCATAATCCTAATTCGTA
AATCTCTTGCCTGCCTACGAGGATGGTTTCTGGTTGTTGCGATGCCAAGCTCTGAACAAAGATTGTAGTGTGTCTGACGCTGGTTTGCAGTTATACGGGC
GGCTGTATGCTCGCTCCGAGGTGCCCTGAGGCGGTTGCATTACACTATTTCCGTCCGATAGTTTCGGCAGCATGCAGACGGACGTCAAGACGTTCACGTT
CGCACAGACCCGCGTCTTGGTGCAGGAGGTCCGTGGCTTCCATCGTCACTCGTGTGTCATGATGCAGTGGCTTGACGCAGGAGCTCGGCGCGTCGGCTAC
TGCGACTGCGGACCTCGATCTCGGCTGCTACGTCTGGCCGTGTGCCATTGCGCTGGCGACGTTCCTCTCGCAGCAGCCGCAGCTTGTTGCATCAAAGGCG
GTCGTCGAGCTTGGAGCTGGCACTGCCTTGCCCGGGCTCTTGGCTGCCAAGCTCGGCGCCGCGTCGGTGCGACTCACAGACAAGTGCATAGCCGACTTGG
TGCCGGCGGCGCGCTCCATCGCCCTCAACCAGCTCGACCCGGCGCGCATCCACACGGTGTTCCATCTTCTTTGGCCGTCGACGCCGCTGATTCTTTCTAG
GCTACGCTCGCATGGGGGTGGCCAATCTCTCGCGACTGGACCTGCGATGTCGTCCTTGCCGCCGACTGCTTTTACGAGCCCGATGGTATGACCCCCAATT
CGTCCATCCTGCGTACGACCGCCAACGAACGACTGGCGCTAAGTAGACTTTGAAGACGCCGTGGCCACGATCGCTCGCCTGCTCGCGCTCAATCCCACGT
GCAAAGCGTACGTGGCGTACCAGCTCCGAAGGTGCGTTGCAAGCCCTCACTTCCACGCGACGCAAAGCGAGTGCTATTAGCGTGCAGCACACGCTGCAAC
CCTACTTGGCGCGTTGGCGTCTCCAGGCAAC