Description :
From Genome Similarity Track
Location :
Scaffold_10:29846- 31855
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_10-snap-gene-0.30Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_10-fgenesh-gene-0.20NADH dehydrogenase

Sequence
2009 bases(100 bases per row)
GGCCTCCGACCGCACGCACGCGCACAACACCCGCTTGAATCTCTCCAGAAACTCGCTGGTAAGGATCCTACTGCAGTAGTCTTGTTGTATGGCGTCTTGG
CCTTGACTCTAACTCTATTGTCTCCATTGCTTCTTTTTTTTGCAGGTGCTTCGCTTCAGCAACGAGAACTCGTACCTGAACTGGGCGAGAAACGGCGTGT
TGTCGTCCGGAGTCGGAGTCGCAATGTACGCGCAGGAGCACCACCGCGGCGCACAGCTGAGTGGCGCGGGACTGCTGCTGCTGGGCTTCGGGTACATTGG
CGTGGGCACGGCGAAATATATTTATTACATCCTGCGCTTCCGCCAAGTCATGGAGCTCTCGTGGGGAAGTGTCATTGGAACCATTTCCCACGCGTCGATC
GCGCTGATTATCTGGCTTACCGCCACGGCGTCCTTCCTGGTGCGTGTGTGCGACATGACGCATGATGCGATTTGCGTGATGCACTGCTCTAATGTCTCTC
TGTCTGTCTATCTTTGCTAACAAAACAAAATAACAGGAAAGCGTGCCGCTGGAACTTGACGCGATGCTGCTCACGGAGCCGATCGCGAGCTTCCTGCCGT
TCCGCATTCGTCAGGGACTCATTGAAACCTACAGCCTCTACCTGGACGACCTGGAGCACCACAACGACGAGCAGGAGCGCGTGCTGCGCGCGATCCAGCG
CGAGAAGGAAGAAGCGCTCGCGCTGAAAGAAGCGATCCTCGTCGAGTCGGCGTCGTCGCAACAGAGCTGAGCTGAGAAAAACCGAGCGAATTGTTCATAG
CTGACGCTGCTGCCTGTGTCTGTGGGGTTGAGGCCAAGCACGGCGAGGGCAGCTGCTACAAAGGTGCAAAACATAAGTTGATTTGACGGCTGAAACGATG
CTGCTTCCACTGTAAATTTCTCATGAGATGATTTGACTCTGCGTGCGTGTAGCCATTATTCCCATTCTCATTCTCCCTGCATCATCAACGCGCTGCTTCG
ACCTTAAATCTCACTTTCGCTGTTAAAAGCCTAGAGATTTGAACAGAAGTATCGATACAGAGAGACCTTGACCAAGCAAAAGAAGAGGAAACGAACGCAC
ACACAGCATGCTCTAAGCCTTTTTCAATCGCCAGCCATCCCCGATCGCTCATTTTTGTGTCTTGATTTTTGTTGATTGTGTTGTTCTCTTTACATGGATA
TTTCGTGCCGCTGACCTACCTTGTGTTGCTCTGCTTTCACTCTCTCGCTCTCGTTGCTTAGTGCTGGACCGCGTCCTTCACAGCCTCCTCCAGGGGGATG
TCAAAGTCTGGGTTTCGGCGCAACGTGACGCCGTCCCAGGTCAGGTTCAGAGGCTCGTAGGCGTCTTCACCCTTCTCAGCCTCAATAATAGGCGCCGCGA
CGATGATGTCGCTCTCGGGGGACTTTGGCAGCGTGAAACCGTGGTCGACAAGGCCCTTCACGATGTCCAGGATCTCCTTGTCGCTCTTGTTCTGCACAAA
CACCTGCTTCTCGACGCCCCAGTCTGCCATACAAACACATAGAGTTCCAGTCGCTAACTGTCAGCATATCTGCTTCCACTGCATAAATATCTAATGATCT
GCTGGATCAAATTTCAAGGCAGCAGAATAACATACCGTAGCGCGCGTACACGAACGGCTCCATCTCCTCCGCCTCTCGGTAGACAAACGGCGTGCGCGGG
TTCAGCATCTTGAGCTCTTCATAGTTCTTGCGGAAGAACGTACTGCATATTCACACATACGTACATACATACAGGACCAGCGAATCAGTACAACGATCGT
TTTCCCACAACACAATTGAACACGCATTGTCGTTCCCCCCTCGCATATCCATTGCGATCTCAATCGCCGCCACAAGAAAATCCATATAGAAAGATACAAT
CAGCAGGAAAAGTGACGCACCGGAGGCCCTGGCTGCTCTGCGAGGTCTCGCAGGCCACGAAGCGCAGCTCCTGGATGCTGCGGGAGATCTGCGCGCGCCA
ACTCATGCT