Description :
From Genome Similarity Track
Location :
Scaffold_109:29843- 31381
Transcript NameFunction/comments
Phypl_g3324hypothetical protein

Sequence
1538 bases(100 bases per row)
AGCAAGCGAGAGCGCCGTCATTTCGCTGTACGGAGACGGATTTCTTGAAATTCCGCTATCAGACACTTCGAAAGGACCGGAGAGCACAGAGCCGTCTCGA
ttgctcggcagcagcgggttcTCGGTGAGTATGTTGCTGTTCAAGGCTGCGGATACGGAAAAGCACAAAGCAAGAGTGTACGGTTTGTGATAACTGTGTG
CGGATGGAACTTATTCAAACGAAAGGTGCTGACGAAAGTGTTGCTGTTTATTCTAATGACTCAAACCTTGGCCATAGCGAGACAGACGGAGCGCGCCACA
AGATGCCAGAACTAGACGACACTGGAGATTTTGTGCGCTGGCTCTGCTGCGGTAGCACAAACCGCAGTATCTTTGGCTGCTTTGCTAGCCTCGACGAAGG
AAACGCGGGGACACGCCAACCAGGTGGATTCTCAAACCTTTATCAAGGTTTGGCTAGCGTCATCGAATAAATATTCGTGCTTGTTTGGTACTGACCTGCT
GTGCTACTGTGCTGGAATAGGACCAAGCGAGTCGACACCGAAATTGCTGTCTGGTAAGCTTCGCGGTGAGAActcggaagacgacgaaacCACGTTTTCC
ATTTATGATCGCGGGGTTCTTCCTAATTATCGGGAGaaaggagaagatggaggctGCCGTGTTCGCTGGCTAGGATGGGAGTGCTGGGCCAACAACTACG
AGGTACCGAGCAACCGCTGGGTCCATCTCAAAGTGGTGTTTGACTGCCGATATCTCCAAATATTTTTCGAcgatgagctggtcgatTGTGCGCGAATCCA
GCTGATCGAAGCCTCCCGTGCATCAAGCAGTGGGCCCCCACGTGGAAGACGCGTCAATTGTAGCTCGGCGTGGGTCCAAGCACCATCAAGCTCCAACTCT
GTGTATGTAGGAGGCCATCCGTCCTATGCGAGAAGTGTCCGCGACTGGCGCGCCAAAATCGGCTTCGTTGGACTGATCTCCTCGTTCAAGCTTTGGAAGT
TGTCAAGTGATCATCCGCGAGTCGGTAGGAAAGCGAATAGCGGGCTGGGTCAGCCTCTCATATCTTTGACCATTCCCGAAGTTGGTAGCGTGCGAGACAG
CTCACCTTTCGAAAACGTTATCAATGCCCATCGAAATGTCTTCTGGAGACTAAATGCTCCTCCAATGTGGACACCGCTTTCTCAAGCAGCGGGTGCACTA
AGCGGTGTATCCCCTTCTTCCACGACAGGATCGATTGTGTTGCTGGCAAACTTTTTTGACGGCGCGCACTGTGACGTGGGAGTTACGAACCCAAAATCAT
TCGAgaacctgctgctcacggcTGTGCAGTCTGGAGACATTCGCACATTGATTGAGTTTGCTGCGGAGTTTAGTGTCCAGCGAAGTCACGATCACGTTTG
CAGATCACAGGCAGAATACGAGCAAAAGTCAAGTGCTCTTGTTGCTGGCATCGAGCAAATGAGCCCGCTATTGACTGTTGTGGTGAACGCTGGAGAAACG
CGTCCACCGATGGGTTTCTTCGAGATTACGATGGAACT