Description :
From Genome Similarity Track
Location :
Scaffold_124:2984- 7377
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_124-snap-gene-0.11Carbohydrate-binding protein
Pytar_ATCC12531maker-par_contig_124-snap-gene-0.12MAP kinase phosphatase
Pytar_ATCC12531fgenesh_masked-par_contig_124-abinit-gene-0.43Possible LRR calcium-binding protein

Sequence
4393 bases(100 bases per row)
AGACGGGCGAGACAATCAAGAAAGACGGCTTTGTTAAAAAGACGCTCGCGGTCGGCGCTGTCGAGGCCTTTCGCTACGGCTCGTCCGGCCAGGCGACGCG
TACGTTCTTTCGTCGCCTTGCTTCTCATCATGTGGACCGTCCTAATGATCTTCTGACTGTAGTCGCCGAGTTCTCGGTCCAAGCGACCACGACGTGGTAC
GACATTGGCATCATCCCGACGGGCACCTTCATCGGGGTACGCTTGTGTCCCTCCCCCTCTCTGTATCCTGCTTGTACCACACTCACTGAAATCGCTGTTC
GCGTACTATTAGCCCGGCAACTGCTCTAGTCTGGAACACTGCAAGGCCGTGACGGGCGGCACGGGCTTTAACGTGGCCATGAAGATCATCCCACGGCTTC
AAGAGGACGTATTCTACCAGAACACGTGCCGCACGGTCAACTGCTTTGCCGACGGCTGCCCCGACGCGTACCAGCACCCTCATGACCCCGACAAGACCCG
CAACTGTCCGTCGAGCGTCAACTTCACGGTCGTCTTTTGTGCGACGCCGTCCACTGGCTCGTTGGACGGCGCCGAGAAGGAGTCGGCCGTGGTCTCCCAA
CCACCGGCGCCCGTGACCTTGTCCACAGCCTCACCAGACATAGCGACCGCATCGTCGCCACCGCCGCTGGCCGTGTCGACGACCCACGCTGACAACAGCG
GCGACGGCACGTCGGTCGCCGTCATCATCGCGTCCATCATTGGCGGCTTTGTCACGGTGTTTGCGGCCGTGATTCTCGTGCGGCGATGGCGATACACGCG
ACTAGAGAAAATGAACGCCACGCGGCACAGCTCCGAGGCCATGGTCTTCATTGAGGCGCGCGACGTGAGCGCACTCTGAAAACACTAGTGAAAGAAATAG
AGAACACATAGGTATTGCGTTAGGTTAGCTCTCTCTCTCTTTCGATGTGTCTCTTCAGTTTGTGTTCACTAAGCGAGAGAGGCGAATAGTGGAGACCATG
GGCCAGCGAGCANNNNNNNNNNGGTGTTCACTAAGCGAGAGAGGCAAATAGCGGAGACCATGGGCCAGCGAGCATCGACCGGAAGGAGAGGCAGCTTCAC
GGGCGTGCTGCCTGCGTCACAGCGAACCGCCAAACGGTCCAGCACACCGTCGACTAGTCCATGCGTCGAGTCACCTGCTACTGCTCGACCCGTGGAAGCT
GCAATTCCAGTGATCCACACTCCACCCCACGCTCTGGACGACAGGAACTCAGAGGCAGCGTTGCTGTCCTCTCCACGCCGCACACTGGATCAGCACGAGG
CATTTGCCGTTCCAGAAAGCGTCCGAAAATCGCGCACGCTCGAGCAATTTGACCAGACGTGCTCCGAGATTCTACCGACCTTTTTGTTCGTGAGCAATCT
CCAGGTCGCCCAGGATCTCGATCTTTTGCAACGCGTCGGCATCACGCATGTCCTCAACTGCTGCAAGGAAGTCGTGTGCTTTGCACCAACTGGTACGGCT
TCGATCACGAACTTGCAGCTCGCGTTGCGGGACGGCGTGCAGGAAGATCTGCTGCCGTTTCTACCACAAGTCGTCGAGTGGATTGATGACTGCCGGCGCA
AACACGGTCGCGTGCTGGTCCACTGCCACCAGGGCGTCTCGCGGTCGTGTGCGTTGGCAATCGCCTACGTCATGTACCATGATCGCTGCAGCTTTCAGAC
GGCCATGGCGCTGGTCAAGGCGAGGCGAGCGATCTGCAGTCCGAACACGGCCTTCATCTGCCAGCTTCTCGAGTGGGAACGTGAGCTTGCTGGACTAGCT
GAGACGACCGAGGACGGACTCTATCGACTTGCACCGCACGCGCCGTACGACGCGGCGACGCTTGTTCTCAAGCAATGTTACCATGGCGAGTCCCGACGCA
AGGTGACACTGTCGACGGAGCGCATGGAGTGGCTGTGGGGCCACGGCATCTTCGTGTTCATCGACAGTCTCGAGAAGAAGATTGTGGTCTGGAAGGGATC
GCAGTGCACAATCGTGGATGGCGTCGGCCACGCGAAAGCCCATGCCCAGCGCATGCTACGTGTGCTGGGTGGGGATATCAGTGCGGAGGAGATGGCGACC
ACGGTCGCTGAAGGAAGCCGCGACGATGTTGGAGTGGACCACTTTGGCTATGCGAGCGAGTTGGCGTGGATAGTGTCGACAACCGACGCTACAGCAGGAC
GATCAGTAATGCCCCGGGAAATGACGATAGAAGACGGAGGGTTAGCGCGTGAACAGAGCGAGGAATCAGTCCCAGACAAGCCCGTGCTGTTCCAGCTGGA
GGACGAGATTTCCCAATGGGAACAATTGACCAACTACGACTCGAACGACTTGGTCGCCTCGAGTGTGCTGTTGCTCGTGTGGTCCATGCACTCAGCCTAC
CTGTGGATCGGGCACGGTCGCCGTGAATTCAATGTGGAGACACTATGTGCAGCAGCGCAGAGTCAATTAGAGAAATGCAGCACCGCCGGGAACACGCTCC
ATGTGGAACATCAAGACACCGAGAGCAACAGTTTCTGGGAGGTCTTTGAGGCTGGTTATTAGTTCATATCAATTCAATTAAAGTTCGTACCCGGCTTCAG
TTTCTGGTCCGCGTGGTGCATTTGTTGACTGCTGCCGTCGTAGCAGTCCGTCGATTGATACTACTTTGCCGAATATCTGGTAGTAAACACCGCACGGCCT
AGGTAACGTGAGAGAAAGATCAGTGCGCTTATCATGAAGTATTGGCAAGGCGTTTCCAGGACGCACGTCAGAGAAGGTGATACTATCGTGACCACACGGG
TCCATGCGGTCGAGCATCTTGTGAAGTTCAGCGTCACTTTTCCGCGGCGCCACTCGTGCCACGAGATCTCGGAACATTTGCTTCGTGAGCACACCGACGC
GGTCACTGTCCACCTCACTAAAGACGAGCCGAAAATGTTCGAGGAGCTTGAGCCGTCCCTGCAACTGGTAGTCGTACAGCAGCTTTTCGAATACGGCAAA
TGGCACGCTGGCTGGTGGAGCCGCAGTAGTGGATCGCCCACCGGAATCGTGCTGACGTTGGTAGACGTCGGCCTTGCGCTTGACGAGCCGCATCAATATC
GAACTCTACAGTTTGAGGCCTCGTTAGCCACCATTCTCTCCCTCCCATGAACCAATCCATCTACACTCACATCGCTGGGGTCGTAGAGATAGAGCAGCAG
CTCGGTCCATTCGTCCTCCCAAATCATACCGCCGTGGAGCTTCGTGTCGACGAGCTTCTGAATCACCGACTCGGTCTTGAGCGGGTGCTTGGCGAGAAAG
TACGCGCGCAGCAGCTCCCGTATGGCCTGCTGAAGCTTCTTCTTTATACCGACAAACTCCTCATCCACTTGGTTCCTCAGCAGAGCGTGGAACATGGCGA
CGTCATTGTCCTGTCGCGTGTACGCTTGGCACCCTTTCCAGATCGCCGCTGCGTACTCGATCGTGAGAGATGNNNNNNNNNNGCAACAGAGCGTGGAACA
TGGCAACGTCATTGTCCTGTCGGGTGTACGCTTGGCACCCCTTCCAGATCGCCGCCGCGTACTCGATCGTGAGAGATGGGAGTCCGAATCGCTGGTTCAA
GTATGTGTAGAGGTGCTGCTCGACGGTCTCGGGTGGTGCACCAATGGCGGCAATGCGGGCGTCGTATTTGGACTTGGACGTGAGAATGCAGTGGACCAGA
TCCACGAGCTGCTTGAGCGTGAGGCTGCGAACCACTGGTGGAATGGCAGGTGGTGACCTGGGAGGAGAGGTTGATCTTGCCACGGTATCAGCTTTAGGTG
AGACCGTCGGCCGGGTTTTCGTCTCTGTCCTAGTACGCTCCTGGCGTTTGCGTATCCGGCGTTGAGGCTGCGCAGTAACTGGGGCCTGCTCGTTTGACTG
CTGGTGCGTGAGTTGTTGCTTGAGCCCATCGCATTCGTTTTGCAGCGACTCGCTCGTCGCTTGCGCCTGCTCGCGCTGGGTCTTTTCCTGATCGTATTTC
GCTTGCAGAGCCTCAAGATCGTGTTCCAGAGTCTCTGCAACATCCAAGAGCAACTTCATCTGCTGCTTCTGCTGGTCGGCAACGTGCTGCTGGCTCGCGT
TCGCGTGGTGCCACTTCTGTTGGGCACGGATCGCATCGTTCACGTGGCCAAGCAGTGCCTCGACGACTTGGGTTTGCGTATGCAACAGCCGATTGATCCC
AGCCCCGAGGTTCTTGTCGATGCTGCCGACCCTGTGTGATGCGTACAATGTCCCGGCCTCCACCAATCTCCAGCGTGCAGCGAGAGACGCCGTGATACCT
TCGTCCTGACTAGGATCTGTTCCTGCCGCGACAGGAGGGGACGTCTCCAGATCGTGGAGCTGAGACGCCAATAGATCAATCTTTCGCTCGAGC