Description :
From Genome Similarity Track
Location :
Scaffold_420:2983- 4963
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_420-fgenesh-gene-0.2Gene of unknown function

Sequence
1980 bases(100 bases per row)
AATTGATACACTGGGTGCATTGCCAAGTGGTCTTCTCCCTGTGTGAGGGGCAATTGGGAGCAATTGGGATCCATGTGTGGACGGAACCGGATGGATCTGT
GGCCATTATGGATACACTGCATGCATGCCAAGGTGTTCTCTGTTATCTTGTATTGAGGAGAGGCGTCGAGACCAGCAGCGTCACGATCGCTTCTCAAGAG
CTCTTCGTGTTGCTGCGTGGTTATACACAAGTGGTGAGCTCTTCCGCCAACAAGTAGTTGTGTTGTGTGCAAGTAGTTGTATTGTGTGCAAATTGGTGGT
GGTGGTGTATTTGTTCGACATGTGTACGTATATATAACTTTAAATATTGACTATAACTCGATAGCGAGCGGAGCGCTCGCGCTCGCTCTTATAAGGCGCA
GATGATCTCGCCAGCGTCGCACTCGCTCATCGCAGTAAGCGCTTCTTGTGCTGTAACAGGCGCGTCACCGAGGATCTCGATGAGGTAGTCGAGGCAGTAG
CCGTCAAAGTCCAGCAGCGACGCGTCCGAGTCGCTGCTGCTCGCGCAGTCGGAGCTCAGCTCCATGCTCTCGTCGTCGTCCAGGAGCGAGTCGAGCGAGT
CGGCGCGCTGGCGCTTCTCCATGTCGATCTCCTCCACGGCCGCGTCGACTCTGGTGGGCGAGCCAATGACGCTGCGGCTGCGCGCCATCGCCGGGATCAC
GACCGGATTGAGTCCGCGACGCACGGGCCCGGTGCGGCGCGCGGTCGTGACCTCGTCGCCGCTCACGCTGCTCTCGGCCACCTTGCAGAGCGTGACCATG
TCTTCGTCGAGGCGGTGCTCAGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAGCTTCCACGGGCCCTCGGGGTAGAGCTTGAGGCCCACGAGGAACTTGTCGTGCTCCTGCGCGGACCAGACGCCGCGCTCG
ATGCTCTTCTTGTCGATCGCCATTTGCGCGCAAGTGACTTGTGTGGGTTTGTTTGCTTGTTGACAAATTTGTGAATGGCACAAGTCGGCGAACTGAGAAA
AATAAACAAAAAAAAGCGACTTGCAAGATGCCTGGTGGCTTGATGTTGCGGTGTGTTTGTGTCATACGTGCACCTCTTCGCGAGCGCGCAACCTTGCGAG
GGAAACAAACAAGTCGTTTAGTCGAGAGACGGGTGTCATACGCCTTTCGGCGAATGGGCGGCGGTTGCGTGCAAAGACGGGCCAATTGCAGCGAAAAAGA
TGGGTACACGCCAGCATTTGCGCAATTCGTCGTGAGCTGGGGAGCTTGCACTTGTTTGCACTTGCTTGCTTGCAAGCGCAGCTGTGTGCTTGTTTGGCGC
AGCAACTGAGTCTAAACTCTGTTTGAGAACAAACACAAACTTCATATCAAGCAAGTGTGATTCTTTTGTGTGGCAAGTCTGTGAAATTAGTCATTCGTCT
GCATGTTGTATTGTACACAGAAAGAGCATCATCGGAAAAGAAGGGGAAAAAATCCATTTTTCACTGATTTTTGCATGAAATTCATCTGGTATAAGATTAA
ACATTCTCGGATGTATGTGAGCTCTATACTGGTGCAACAACAAAAATCGTGGTAAAAATCGTCCAGAAAACTAACCAGATGGTCAAATTTCACCTTAGGC
CGAAGGGAAAATCCAGTCTTCTCGACGGTGATCGAGAGCTTGCCGAGCTGCTGATTTAAGCAACATGGACGGCGCACAAG