Description :
From Genome Similarity Track
Location :
Scaffold_6:298292- 300205
Transcript NameFunction/comments
Physo_128905PREDICTED: myosin VC

Sequence
1913 bases(100 bases per row)
CGGACGGCGCCAACGACATGTGCACGCTCAACCACCTGCACGAGCCCGCCGTGCTCAAGAACCTGGAGCTGCGCTTCGCCAAGAAAATGCCCTACACGTA
CACTGGCGCCATCTGTATCGCCGTGAACCCGTACCAGTGGCTGGACCTGTACGGTCGCGAGCTGTACCAACAGTACTTGGAGCAGCCCCGGGACTCGCTG
GCGCCGCACCCGTTCGCGCTGTCGGCCACCGCCTACTTGGACATGAAGCGGACGCAGGTGGACCAGAGTATCCTGGTCAGTGGCGAGTCTGGAGCTGGTA
AGACCGAGACGGTCAAGATCATGATGAACCACTTGGCCTCGATCTCCGGGGGTGGCAACCACGGCACGAAGGTCATCGACCAGGTGCTCAAGTCCAACCC
GCTGCTCGAGTCCTTCGGTAACGCCAAGACCAAGCGCAACGACAACTCCAGTCGCTTCGGCAAGTTCGCTCAGCTGCAGTTCGACAACCTCGGATCGCTC
GTTGGCTGTCTGTGTGAGACCTACCTGCTCGAGAAGAGCCGTGTAGTGGGTCAGACGGAGGGCGAGCGCAACTACCACGTCTTCCACCAGATCTTCTGCC
TGCCGGAGGAGCGCAAGGCCGAGCTCAAGCTCAGCGGCGACGCCACCAACTACAAGTACGTGTCGGAGGGTGCGGATGCCGAGCTCACAGGTATCGATGA
CGTCCAGTGCCTCAAGGAGACGCAGGACGCTCTGGATACTATTGGCATCTCGACAGACGAGCAGAACGCCATCTTCGAGATTGTCGCGGCGATCCTGAAC
CTCGGAGAGGTCGAGTTTGAACAGAACGGCAACGACAGCGAGAAGTGCCACGTCAGCAACGAGGACATCGTGGACAACGTGGGCGCTCTGCTGCGCACTG
AGAGCGCGGCCCTGCACTCGACGCTGCTGGAGCGCTCGATCACGGCCGGCTCCGAGTCGTACACGATCCCGCTGAACGCCGAGCAGGCCTCGGACCTGCG
TGACGCTCTGGCGAAGGGCATGTACACTCAGCTGTTCGACTGGCTGGTGCACCGTATCAACAAGGCTATCTGCTCCACGAACAACGTGAAGACGCACATC
GGTCTGCTGGATATCTTCGGTTTCGAGAGCTTCGACCAGAACGGCTTCGAGCAGCTTTGCATCAACTACGCGAACGAGAAGCTGCAGCAGAAGTTCAACA
GTGATGTGTTCAAGGACGTGCAGCAGGAGTACGTGGACGAAGGCATTCCTCTTACGCTCGTGACGTTCGAGGACAACCAGCCGATCCTCGACCTGATTGA
AGGCCGCATGGGTATCGTCAGCCTGCTGAACGAAGAAGTCCTGCGTCCTCAGGCCACGGACAACACGTTCGTGAGCAAGGTGCTCGACGCTTGTAGCGAC
CACCCGAGCATCGAGAAGAACAGAATTAACCCGCTGGAGTTCACTATCCACCACTACGCTGGCGACGTGACGTACAACGGTACGGGCTTTTTGGAGAAGA
ACAAGGACACTCTGCCTACCGACATGGTGCAGCTGCTGTCGGGCAGCCAGAACGGCGTCATCTCGGGCATTTTCACCCCCACGCAGAAGAACAAGCGCAA
CAGCCGCGGCAAGAACGGCAAGGAGGGCCGCCAAAAGGGTTTCCTTGTGGGTAATACCATTGCCGGCGCTTTCCGCAAGCAGTTGTCGGAGCTGATGGAG
ACCATCAACAAGACGTCGTCGCAGTACGTGCGCTGCATCAAGCCGAACGCCAACAAGAGCGCCGTGGAGTTCAACCGCGTTATGATTGTGGAGCAGCTTC
GATGCGCCGGTGTGATTGCCGCCATCCGAATCAGTCGCGCGGCTTTCCCTAACCGTCTGCCTCTGGTGGAGTTCCAGCAGCGTTTCCAGATCATCTGCCC
GTCGGCTCTGCGC