Description :
From Genome Similarity Track
Location :
contig_14:298236- 300536
Transcript NameFunction/comments
g3706.t1hypothetical protein

Sequence
2300 bases(100 bases per row)
TTGCCGCCAACCTTTTTGATATTTTCAACTCGTACGCCTTTTTCCGAAGCTCCAACGTCGTATTCGACGTCAAAGGTGCCGTCCGACCTCGCGCGTACGA
CTTTCCCACGATGAAACTTGCCTTTCTGCTTGAAGTTGGCCTCGACAATGTCACCAGCTTTAATGGTTCCGCTCTCCTTACCGACGCGCTTCTTGCGCTT
GCTGTCTGAATCCGAGTCTCCAAAGATGTCGTCCTTGTCGACACTTGCCTTTGCCTCGGGTTTCTTCGCTTTACTACCAGGAATTAACGCGATAGATGAG
CTCTTCACACGTAACTCCGTGTCTCCGTCGTCGTACTCGATGTCAAACGTGCCATCCACTCGGGCCTTCACAATCGTACCCGGGTACGTTTTGACCCCTC
CCTTGTACTTGGCATTGACCTTGTCACCCTCAGTAAAGCTTTCAGGCTTCTTCTCCTCTGCCTTCGCTCGTGCTATGGGCTTTGCTTCCCCTTCGATGCA
GGAGCGCTCAACGTACATCTCGGTGTCTCCATCCTCGTACCTGATGTCGTACGTACCATCCGACCTCACGCGGGTGATTTTACCAGGGAACAGCTTCGCC
CCCTTCTTGTAGCGCGCCTTGACGCATCACCAACCTCGAATTGCTTCGCTGTGGACGGTACCGGTGAGTCTGCACTCGGTTTGGACGTCTCAGGCTCAGC
TGCAACGACGAGAGACGAATCTACGCGAGTTTCGGAGTCGCCGTCTTCGTATCGGATGTCGTACGTTCCATCAGGTCGCACACGCTCAATTGTGCCCGGG
AAATACTTCGCCCCCTTCTTGTACTTGGCTTGGACTGCGTCTCCAACAGCAAACCCCGTCTTCTTCTTCTGAGAACTCTCCTCCTTTCCCTCTTGCACCT
TGATTCGTGACCTCGGGACGCGTCGATCGGAGTCGCCGTCGTCGAATGTGACGTCGTAGGTGCCATCAGAATGGACGCGAGATATCTTACCAGGAAACAT
CTTGACGCCGTTCTTGAAGTTGGCTTCCACCAAGTCCCCAACCTGCAGCGTACTGGGGCTTTTCTTCGATGGTTGTGGGTCTCTTTCGTCGTCTTCCAGC
TCGATATCTGTGGCCTCCACGTCCTTCTCCTTATCGCCATCGTCGTATCGAACATCGTACGTGCCGTCACGGTGGACAGCAGTGATCTCGCCGCGAAACA
TCTTGCTCCCTTTGTTGTAGCGAGCACGCACTTTGTCGCCCAACTTCAGGCGCTGGATTGATTTAGGCGAGTCAGGTCTGTCGTCTTCTTTGCCCTTTTT
GCTCTCGAGCGCTTCGATCATCTCCAAGGCGACTCGCATTTCGACGTCTCCATCGTCGTATTTGATATCGTACGTTCCATCGCTGCGAGCTCGCGCCACC
GTACCAGCAAATAGCTTCTTGCCGTTCTTGTACCTCGCCTTCACGGCGTCTCCAACCTCCAAAGTGACCTTTTGGGGCTTTTCGTCGCGCGGAGTCGGCC
CCTCTTCCGGTTGGATGCGGTCACTCGGGACACGGGTGGCTTTGTCTCCATCGTCGAAGGTGATATCGTAAGTGCCATCGCTGCGTACACGAGAAACTTT
ACCTCGAAAGAGTTTGGTGCCTCCCTGAAACGGTGCTTTGACAACGTCGCCAACTTCTAACGATTTCTTCGCCGTCTTCTTTAACTTATCATCGTCTTCG
TCGCCATCTACGCGCTGGATGAAGTCTACTTCGACGCGTTCCTCAACATCCCCGTCCTCGTACTTGACGTCGTACGTGCCATCCATGCGCTCACGAGTGA
TTTTCCCTGCGAAGAGCCTTGCTCCGCCTTTGTATTTTGCCTTCACAGCGTCGCCGACCCGAAGTGGCCGCTGCGTCGAGCTCTTCGAGCTTGTCTTCGG
GCTGTCTTGTGCCTTCGTTGACCGCAGTTTGTCTGCGTCAGTTTTATCCGACTCGGCATCTTCAATCAAGCTTGCTTCCACTCGAGCCTCCGAGTCCCCA
TCGTCGTACTTGACGTCGTAGGTCCCATTCATGTGAACCTTCGCGATTTTGCCCGGGAATAGCCTCTTTCCCTTGCCGTAGTACGCTTTCACGCGATCGC
CAACGCCCCACTTGCCTGTCTTCTTTTTCGTAGCTGGTTTCTTCTGGTCCTCATCCGAATCTGCAAACATGTCCTCAGTGTCGCTGACCTCGATTTGGTT
GGCTTCCACGCGGGCTTCGCTCTCGCCATCGTCGTAGTCGATGTCGTACGTGCCGTCGGAGCGCACTCTGCTGATTTTCCCTGGGAACAAGCGCTTCCCC