Description :
From Genome Similarity Track
Location :
Scaffold_738:2980- 4045
Transcript NameFunction/comments
g17095.t1hypothetical protein

Sequence
1065 bases(100 bases per row)
CACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAG
GACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGA
TGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACCATCATGGCCGGCGA
CAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATC
CAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGT
ATGTGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGT
GTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTGGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGA
GAGTCACCATTCCCCCTCGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAG
ACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTC
CGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACAC
ACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACG