Description :
From Genome Similarity Track
Location :
Scaffold_2860:298- 2387
Sequence
2089 bases(100 bases per row)
GTCCCATCCGTGAACCAGGTAGAAAGGCGTGTCCAAACGAGTAGCGTCAAACGAAGTGTTCAGGGCGAATATTAGTCTTTCAGCATGATCGTCCCAATAG
CTTTGGTCGGCTTCCGAAATGTATGCTCGGATACTCCGAACGACAGTTTGGACTGATCGCTCTTGTTGACCATTGGCTTTCGGACGGTACGCTAGCGTAG
CACGTTGCCGACTCCCCAAGAGCTCTCGAAAGCGAGTGGATACTTCGCTCATAAATCGGGGATCTTGGTCATGTCGAAGCAGCGAACTCGCCCCGAATCT
CCGGAAGACACATTCTTCATAGGCCTCTGTCACGTCTTGAGCGATCGTCGAACTCATCGGCTTGCACATGACGAATCCGGAGAAGGAGTCCTGAAACAGA
AGCAAGAAGGTATTCCCACGGTCCGACTTCGGCATGTGAGTTACAAAGTCCATGGACACCAGTTCGAAAGGCCTTCTTGGTTCAATATTTCCGGGCGATG
GACTGGGGTTCGGAGGTCGTCCCTTACCACTCGCGCAATCCATACACTCTTTCACGAATCGTTCCACATCGGCATACATTCCAGGCCAATAAAACCCAGA
ACGCAATTTCTCATGCGTTCGAGTGATGCCTGGTGTTCGCCTTGGTAGTCTTCATGAGCGTAATGCAACATGTCAGATCGGAGTGATTCCGGAACGACGA
GCCTCGGTTCATCCACAACGTCTCGCGGGCGATCTCGCGTCGAGCGCGCCAATCGATACAGGATGTCTCGAGCGTCCAACGCGAACAAGTCAGAAATCTT
GGCGATCTTCCGGAGGCGGCGAGGGGAGAATTGATCGACGTCCCCTTTCAGAAAAGCCTTGATCTCCGAAAGATaatcgtcttcatcctgaTGCACCTTA
GTACGTCGCCAACGTTCCGCCTGATACTCCAAGGGGTTCATCGGTTGGTCGTCTGGACGGGGCTCGTGCTGAGTTCCCGACCGAGTAATAACGGCCATGA
CCTTAGCGGCATGAGATAACGGCGCAGATCCGGCATCCGGAAGAGCATCTTTTTTCGGTTCATCATTCGGACTCACGACTGCAGCTGAAACCTCGgactt
catcagcttctcgGGAATTTTGGACACCATTTTCAGGTGAACAAGCTCATCCTCTTCTAGGACGTCCCATAACTTTTCGAGAAGAAGAGTCTTCGAAGTT
AGATAGTCAGCGGCCTGATTATATTCTCGTTTCAAGTGCACCAGCCGGAGAGACGTGAACTCTGCTTTCAAAACCTCCGCATTTGCTAAATGTCTCTGCA
AGTGAGGTTGATTACAGTTAATCAGTCCCTGCACCTGCTGTATGACGATCCGAGAATCACCGACGACTACCAAATCCCTGATTTCCCGCTCAACCGCCAT
CAACAGTCCTTTTAGAAGTCCGAAATACTCGGCGTCGTTCACCGTGACATCATTTAGAATGAAACCCTTTGCTTCTAGAACCGTCCATCCAGGTAGAGTC
GACAAGACACATCCACAACTTCCAAGTCGGGTCGACGTCTTGGCGGCTCCATCGAAACTCAGGACGACATCTCCATAGTCAGCTTCCAACATCTCCACGC
TCACCACTGGTGGTTTTCGGACTTGTCCCTTCGCGGGAATCAATGATTCAGCAATCTCATCTAGATGTTCGCGTGGGGTAATACCCGCGCCCATGATGGC
TGCCAATCCGTCCTCATCACGCTGGGCTTTCCGAATCTCCATATCCCAGTGCGACAGAGTAACTCCCACGGAACACACCGGCTATCCGCAGACTTCGACT
TGATTACCCATTTCAGAACGGAGTATCTCGTATAGATGATCAGAGGACAGCGGTCGAGAATGGCCTGAAAGACTTGCAACACGCGCATGATCGCGATGAA
TTCCTTTTCAGCGATATGATATCTCAGCTCGGCGTCATCCAGAACGTGACCTGTATACCTCATTGGTTGGATGACTCCGTCATATTCCTGACCTAGGACT
GCACAAGCGACCCACTGGTTCGCATGTGGAATAATGATGAACGGCTCCATCCGGTCCGGATGATgcaacagcggcgtcgaAACGATCTT