Description :
From Genome Similarity Track
Location :
Scaffold_3033:298- 1939
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3033-snap-gene-0.1Myosin

Sequence
1641 bases(100 bases per row)
TCGGTATCACGACGGAGGAGCAGAACGCGATCTTTGAGATCGTGGCGGCGATCTTGAACCTGGGAGAGGCCAACTTTGTGCAAAGCGGTTCGGAAGAGAA
GTCGCACGTGCAGAACGAGGAGATCGTGCAGAACGTGGCACACCTGGTGCAGACGGACGTGGAGGCGCTTCGCAGCGTGCTGTTGGAGCGTTCAATCACG
GCCGGTACCGAGTCGTACACGATCCCACTGAACGCTGAACAGGCGACGGATCTGCGTGATGCGCTCGCGAAGGGTATCTACACGCAGCTGTTTGACTGGT
TGGTGCACCGTATCAACAAGGCGATCTGCTCGACGCGCAACGTGCAGACGCACATCGGTTTGTTGGATATTTTCGGTTTCGAGTCGTTTGAGACGAACGG
GTTTGAGCAGTTGTGCATCAACTACGCGAATGAGAAGCTGCAGCAGAAGTTCAACAGCGACGTGTTCAAGGTGGTTCAGCAGGAGTACATTGAGGAGGAC
ATTCCGCTGACTTTGGTGACGTTCGAAGACAACCAGCCGATCTTGGATTTGATTGAGGGTCGCATGGGTATTGTGAGTCTGCTGAACGAAGAAGTGCTTC
GTCCACAGGCGAGTGACACGACGTTCGTGAGCAAGGTGGTGGACGCATTCGGTGACCACCCGAACATCGAGAAGAGCAAGTTCAACCAGTTGCTGTTCAC
GATCCGTCACTATGCTGGTGATGTGGCGTATAACGGTACAGGTTTCTTGGAGAAGAACAAAGACACTCTACCGTCGGATATGGCTCAGCTTCTTCAGGGC
AGTTCGAGCAAGGTGATTGCTGGCATCTTTACTGCCGAGGCTGCTCCAGCAGAGCGCAAGACTGGCGCTGTCTCGCGCACAGCAAAAGGCAAGCCAGCGC
GCCAACAGAAAGGTTTCTTGGTCGGTAACACGATCGCTGGCGGGTTCCGCAAGCAATTGTCCGAGCTGATGGAGACCATCAATAAGACGTCATCGCAGTA
CGTTCGTTGCATCAAGCCGAACGCGAACAAGAGTCACGAAGAGTTCGACCGTATGATGATCGTGGAGCAGTTGCGCTGCGCTGGTGTGATCGCTGCGATC
CGTATCAGTCGCGCTGCGTTCCCGAACCGCCTTCCATTGTCGGATTTCCAGTCTCGTTTCCAGATCATTTGTCCATCTTCGCTTCGAAACGCGTCTCCTG
TGGATATGGTCGTGGGCTTGTTGAAGGAGCTATTGCCTGAAGCTGCCGCTAACACAAAGAACAGCAAGTTCGCGGTGGGTAAGACGAAGGTGTACTTCAG
TTCTGGTTTGCTGCAAAAGTTGGAAGACCGACGAAATGCGATTCTGAAGGACCATGCTCTTAAGATCCAGAAGACGCTTCGTGGATACGTTCTTCGCAAG
CGGTTCGTGCAGTTGCGCGCGGCGACGATCAAGATTCAAGCGTTCAGTCGAGGTGGATTCCAGAAGATGCGCTTCCGAAAGTTTCGTGCTGGTGTGGTCA
GAATGCAAGCCCGTCATCGCGGCCGCAAGCAACGCGTGGTTTTCGCTGAGTTGGTGATCAAGGTTCGACGAGAGCGACAACTTGCTTTGGAGCATGAGCG
TCAAGCGCAGCGTGAACGTGAATTGGAAGAGCAGCGCGTGC