Description :
From Genome Similarity Track
Location :
Scaffold_1440:298- 1809
Transcript NameFunction/comments
Phypl_g13413hypothetical protein PHYSODRAFT_352808

Sequence
1511 bases(100 bases per row)
CCCTAGAAACGAACAGTGCGAATTCGAACACGCTTTTCACCGACTCGCTCGTACGAAGACATCAACGATGGGTTCCTGGTAGAACCTTTGGGTTTGCAGT
CCAGGTGACAAAGCTCGCCCTTAGTTAGGTGGATCAAACCCTTGGTAGACTCATCTACCATTAGTACTACCATGGTGGGCGAATTATCATGCATTTAACA
CTTGAAATGTGTCTTATCTACTCGACAGGATCAAACGCGTAGCATGAGTCCAGCACAGAAAGCACGTCCATCCGAATTCCCAGGTAGAACATACGCCTTC
GAAGTAGTTGAGGCGCGAAGTTGctcggcagcggcgtcgcGTCAAAGCCGATAAGGCACTCCATTGGGAAGTCGCCGTCGTAGCTGGTAGACGTGCCGCC
GTTCGGTCTGCGATTTTGGCGTGGCGTGACGTAGGAAGGCGTGGGGTTATACAGCACGTTGGCAGACGCTTTGCCTCGGTTCTGGAGGCCCTCCGGGAAC
GGGTCCAGAAGGGCCTTGCCATTCACGTACAGCAACTCGGGCGTATCGTCCCCAACGGGCATGAAGTGCGCCAGGCTACCGCACAGTGAGTCGGGATGGT
TCTTCATATCGTGGTTCCGAGACGACTCAATCACACTGGGACCCCATGGCGAGAAGAAATACGCTTGCTTCGCCAAGGCGTAGGCAATCCAGAACGTCTC
CTTGTCTCCGAACGAGAACTCGCGCTCAAACCGCTGCACCGTAATGAGCCAGAACATGACCGACATAGCCTGTCCGGACCGCGACTTGTCCACTGCCACC
AAGGACGAGTCCTGCTCGTGCGAGGCCTCCCCCCTGTACGCGTAGCTGCGCTCCAGATTATCCGGAACCTCCGCGCCGTCACTCAATCCGAACGCAGCGT
AGTCGAACGAgttcagcagcgtcttcaagTACGTCGAGTTGTTCACCTCCTGGTTGAACCACTCGTTGCTCCACAGCACTCGGTCGTAAAAGAACGTCGT
GCCGGAGCGCTGGTACCCGTCCGTGGCCCTCAAAGCCGCCGGGTCCTTCAGGAAAACACCATCCACATCCATCAACAACACCTCCTTGATGTCCGTATGG
TACAGCGCCAAGGGCTtgagccaccagctccggAACTTGTCGGCCGTGTCGCGCGTCATCACCCCTTGAGCCACCAAATCCGTGCAGACATCCACGATCT
CGACCCTCGCGTCCGCCCCCAATAGCAACGCTCGGTTCGCGTCCGACATCTCGTCGGGGAAGCAGTGATACACCTGGATGAGCTCCTGGTTGCCGAGACA
GCGGAGGTCCCGGACCAACGAAAGCCCCAGGGGCACCGCCGCGTTGTGCATGCACATGACGATCCCTTTGCCCCGCGACACCGACGCGTCGAATTGAGTG
ACGACGGTCTTctgcttgcgctggtggATGCCGGAGTTGGCCCAGTGTCTGGAATGGCTCCCCATTGACTggaagacgctggagaggagcgcggtggacg
cgatcgccacg