Description :
From Genome Similarity Track
Location :
Scaffold_5373:298- 1404
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_5373-fgenesh-gene-0.0Sodium/glucose cotransporter

Sequence
1106 bases(100 bases per row)
ATGCTCAAGATCCTGCCGCCCTTCATTATCGTCGTGCCGGGCATTGTGGCCGCGATCCTCTACGACATGAGAGTGCCGGCCAGCAAGACGGACGCCGCGT
ACCCGATCCTGCTCACCAACCTCATGCCGCACGGCGTGATCGGACTCATGGTGGCGAGCATCATCACGGCCATGATGTCGAGCCTCGCGTCCGTGTTCGC
GGCCGGCTCGGCCGTCATCACGAACGACATCTACCTCAAGCTGCGCCCGGACGCGACCCACGACCACCTCATTTGGGTCGGCCGCGTGAGCACGATCTGC
TTCGCCGTGCTGAGCTTCTGCTGGATCCCGATCCTGAACGGCGGCGACGGACTCTACAAGCAGATCGTGGAGATCCAAAGCTACCTCACGCCGCCCATCG
GCATCGTGCTCATCCTGGGCGTCTTCTGGAAGCGCGCGAACGCCCAAGGCGCGCTCACGGCGCTCCTCTGCGGCGGCTGCCTCGGACTCGTGCGCCTCAT
CTTCGTCACGATCAAGAAGAACACACTCAAGGGCCACTACCCGAAGGTCATCGACCAGTTCTTCTACATGAACTTCCAGCACTTCGCCATCCTGCTCTGG
GGCACGTCCATGTTCATCTGCGTGGTCGTGAGCCTCTGCACGCCGCCGCCGCCGGCCGAGTCACAGAAGTACATGGCGGACCTGAGCACCATGTTCAAGC
TCGACGCCACGGAGCTCAGCAAGCCGCGCTACGTCAACATCCTCGTGGCTGCCAGCGGCGTCACCTCGCTCATCATCACGCTCAGCATGTGGATCTACTT
TGCCTAGGTAGCTCACCCAGAAGCCGCCTCGTGTGTGGCTTTGTGGCTTTTCTTTCATATATCAACCCAAGTGGTGTAATTGCACGTTTGCTTATCCTTT
GACGCTCGCGTGTTGACTTTGATGAAGGTCTCGAAGGTGCCCCACAGTTGTTTGCCTTGGGGCCTCGCAGATCCACACACGCGAACGCCGTGGAGTCTGG
AAAGAAGCCTCGGAGCGCCGCCAGAGTCGCAACAAGTGCGCATTAGCCTCTTGAACAGACTGTATCGCATCTATTAACCACGTGAATCAGCAAAAGTTAA
TCCATT