Description :
From Genome Similarity Track
Location :
contig_42:297965- 299154
Sequence
1189 bases(100 bases per row)
ATAAGTTGTACGTGAAACTGGCCAAATGTGTCTTCTGTGCGGACGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAACGGTGTTCGTATGGATCCGGA
CAAGGTTTAGACCATCAAGAACTGGCCAGTGCCTCGGACACAAGAGGAGCTTCACAGCTTTCTGGGTCTAGCAGGCTACGTTCAATGCTTCTGTCCAGAA
TACGCATCATTGATCAGCAACAATGTTTGCTCTGCTGAAGAAGAAGAACAAGCGTAACGCCAAAATCCATTTCAGTGATGAACAACTGAAGAACTTCAAG
GAGTTGAAGCGACGCTTGTGTAATCCGCCAGTACTGAGCTTGCCGGACTTCAGTAAGCCAATGCACCTGCGTACTGACGCAAGTAAGTTCGCGGTTGGTG
GTGTGCTATTTCAAGTCATCGATGATGTTGAGCGACCCATTGCCTACAGATGAAACCAGCTGAGTTAAACTATCCAACGCAGCAACACGAACTTCTAGCG
ATTGTGCATGCGCTGGCAGCTTTCAGAATTTACTGCTTGTATCAACCACCGGTCATCGAAACTGATCACAAGAGTCTGGAAGGAATCTTCACTCAAAAGA
TGGCAAATCGTCGGTTGGCACGGTGGTACGACATTCTCGCGGAATACCAACTACAATTTTCGTGTCTGCCTGGAGCGCAATACGGAATTGCTGACGCCTT
GAGTCGACGTCTAAATTTGCAGCCGGAGACTAAGTACTTCCATGACTTAAGTATTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCAATC
ACGACGACAGCAAGCTAATCCAGTCGATTAATGCCGCGTATACCAAAGATCGAGAAGCTCAAGCGATATTCGCTACTATCCGAAGGCGACGTGAACGTAC
GAGCAAGCGTGTCGACCGTCAGCACCGGAAGAAGTATCGATGTTACCATGAAGATCGTGGACTACTGTGGTATCAGACAACCAGCGATGATACCCCTCGT
GTAATTGTACCAAACTCGGTAAAGGTTCGGCAACAGATTATTCGTGAGTGTCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATACCTCA
CACTGCCACGTCACTGGTATTGGACCAAGATGATCAAATCCATCCAGAAGTTCATCGCTGACTGTGAACCGTGTCGAAGAAATAAACCT