Description :
From Genome Similarity Track
Location :
contig_42:297941- 299130
Transcript NameFunction/comments
g9084.t1hypothetical protein

Sequence
1189 bases(100 bases per row)
ATAAGTTGTACGTGAAACTGGCCAAATGTGTCTTCTGTGCGGACGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAACGGTGTTCGTATGGATCCGGA
CAAGGTTTAGACCATCAAGAACGGGCCAGTGCCTCGGACACAAGAGGAGCTTCACAGCTTTCTGGGTCTAGCAGGCTACGTTCAATGCTTCTGTCCAGAA
TACGCATCATTGATCAGCAACAATGTTTGCTCTGCTGAAGAAGAAGAACAAGCGTAACGCCAAAATCCATTTCAGTGATGAACAACTGAAGAACTTCAAG
GAGTTGAAGCGACGCTTGTGTAATCCGCCAGTACTGAGCTTGCCGGACGTCAGTAAGCCAATGCACTTGCGTACTGACGCAAGTAAGTTCGCGGTTGGTG
GTGTGCTATTTCAAGTCATCGATGATGTTGAGCGACCCATTGCCTACAGATGAAACCAGCTGAGTTAAACTATCCAACGCAGCAACAAGAACTTCTAGCG
ATTGTGCATGCGCTGGCAGCTTTCAGAATTTACTGCTTGTATCAACCACCGGTCATCGAAACTGATCACAAGAGTCTGGAAGGAATCTTCACTCAAAAGA
TGGCAAATCGTCGGTTGGCACGGTGGTACGACATTCTCGCGGAATACCAACTACAATTTTCGTGTCTGTCTGGAGCGCAATACGGAATTGCTGACGCCTT
GAGTCGACGTCCAAATTTACAGCCGTAGACTAAGTACTTCCATGACTTAAGTATTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCAATC
ACGACGACAGCAAGCTAATCCAGTCGATTAATGCCGCGTATACCAAAGATCGAGAAGCTCAAGCGATATTCGCTACTATCCGAAGGCGACGTGAACGTAC
GAGCAAGCGTGTCGACCGTCAGCACCGGAAGAAGTATCGATGTTACCATGAAGATCGTGGACTACTGTGGTATCAGGCAACCAGCGATGATACCCCTCGT
GTAGTTGTACCAAACTCGGTAAACGTTCGGCAACAGATTATTCGTGAGTGTCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATACCTCA
CACTGCCACGTCACTGGTATTGGACCAAGATGATCAAATCCATCCAGAAGTTCATCGCTGACTGTGAACCGTGTCGAAGAAATAAACCT