Description :
From Genome Similarity Track
Location :
Scaffold_1868:2979- 5809
Transcript NameFunction/comments
Phypl_g14297hypothetical protein
Phypl_g14298reverse transcriptase

Sequence
2830 bases(100 bases per row)
CGGCGATCTCACGCTGGCAATCGCTGGAAGAAGGTCTTGCAGATCTTGATCCAGGCGATGATCGAGGGCTGGTGTGATCTCGATCTTCTGCTGGATCCTT
TCTTCATGCATTTCCcccaagaagacggacgCTGTCGTCTGGTATCCAGGAATCGAAGCGCGTCGGGCGAATCTCGCCGATCCGCAGCTGCAACGCGTCG
AACCGGCCAGTCTGGTTGAAGCTCTAGTCGAGTGCGACGCGGCTGACCCATGGCGCAATCACTACCGCACTCGCCCCGATGATCATCCCGCGCGTAATCT
GACTCGAatcgtggacaagttctTCGGTGTCCGAGCCGCGTCCGCACCAACCGAGTGAGTCTGGATCGCGATCTGGTTCAAGTGAGATCTGATGGCCCGT
TGATACGTAGTCAGCAGCAATTTTGTCTTCGTCAGATCTCGTGACGTAACTTCATCATCAATATATCTTTTTCACGTAATCGTTTGTCGCCTTTTGCTCT
TCCACAATCCCTCTCTCTTCATCTGGCGATCCTGCCTCCACGTTCACACTAGGCGGTCTCCGGAGCGAGAAACCCTTCAGTCCTGTGATCTAGCGGCCAC
ACCGCCTGATCGTCACATATGCATAACATGCAGCCCTTTCTTCGTTACCTGCAGCCTTCCTGCAGGTCCCTCAACACTGTCTCCGTCAAGATGGCCAACC
CACATCGCCGGATCGCCGCCTCACTCTTCCTCGTGAGATTGCATCACGCTGAACAGGTTGTGATTCGCGCGATCCCGCAGGAACTCATGCAACAAAGCAC
CACAATTGAGATCTGCTTCATCAACCCAGCTTGGATCCTGATACCTCGCCAGTGCACCAGAAACTCGCGGTAGATCCGACCATATCTCGTCTTCTTGCCA
GTCCTCATGTCGGtgatcttctccacctcgtaTTCGTCTGCATCTAGATCCGGGATCCAGCTATCATCAGGTAGCAACACCTCGTCAAAGTCCAAGCGAT
ATGTCTCTTCAACCGTCAATCGGATCTGCGGCCGATCGGGGAAGGCTctcacgagcttcagcttggagACATGCACTACTGGGAATATCCGGTACTCTGA
TCCCGCGATCTCGAGTTTCATCGCATACTCACTGACCTTCTCCGCTACGCGGAAGGGACCGTGCCACAGGTGAGCTAGTTTCCGAGCATAGCCCACTTTT
ACTCGATCCAAATAGAGCCACACACGAGATCCAACTTCCATTTGGTGTGGCTAGATCTCCTCGTTGTGTCGATCTGCCCGTCCGACGATCGCCTCTCGCA
GACGCTCATTGACCTGCTCACGGGCTTGCTGATAATATCGCTGGATCTGGTaacgccatcgtcgtggaTCTCGATGTGTCCGTCGCGTACTTCCAACCGG
GATCGTAGCTTCGAGAGTGGATCTCGGATCCCACCCGTGCACCAAGTAGAACGGGGTGTCGCCGCGAATCCTATCCTGAGCCGTGTTGATTGCAAAGGTA
AGTCGCTCGGCGTATTCGTCCCAGTCTCGTTGATCCAGATCCTGGATATACATCTTCAGCGCCCTCGTGATAGTCTGCACCATGCGTTCCGCTGTTCCGT
TAGCCTGTGGTCGATACGCCATCGTTGCCCGCTGGCGTTGACCCAAGATCTTATTGGACGCTCGGAAGAAATCAGACATGAAACCAAGTTCGCGATCATA
TCGGATCGCCTCGCTCGCTCCAAATCGTCGGAAAACACACTCTTCATAAGATTCCGCAATTGTCTGGGCCGTCCTGGACGAGCTAGCCTTCGCGATCACG
TACCCCGTGAAGAGATCCACCCAGATCAACATCTCAGTATTGGCTTTATAAGACTTCGGTAGCGAGGGAATGCGATCCATCGCGATGATCTGGAACGGGT
AGGTCGCTTGGATGTTCCCTGGCGACTCTCATTGGATCCGTGGTCGCCCCTTGCCGGTCTCACAGTCGACACATTCTCTGCACGCTTCGATAGAGACCTC
TCCAATGGAAGGGATCCCGGATCCGCTGATTGGTACGGCCAATCCCTTGGTGCCCTCCTTCCAGACTCGCGTGGTAATGATGTAGAATGTCTCGATGTAA
CGTCTCAGGTGCAACGAGCCTCATCAGTCCGTCGCGATCTGCATCAGCACGTTTCGTAGGCGAGCAATAGAAAAGTAGATCATTTAGATCCACTTCATAA
TCCATCGCAACGTTGCTATAGGATCtagcttcttcttgcgtcAGATCGCATACGCCACCCGCCAAATACTTCTTCAACCCTGAGATCCACGCCTCCTCAT
CCTGTGCTTGCCGGATTCGATCCACCCGGAGGTTCCTAACGAACTCTCCCTGCAGGACATTGGGGCTGGATCTCGACCGAGTGTCGGATCTAGTCATCAC
TGGCGAGATCCGGGCCACTGGATCTTCAGACCGAGGGATGAGCACTTCATCTAGGCGGTTTAGCGTAATCAGATCTTGCCACTCAGCTTCGTCCTCAATC
ACTACTCCAGCTTATCGGTggagcgccgcgctggccaaACTGTCTGCACTGCCATTCCAGTCTCTCTTCACATGCACCAAGTCGTGATCGGGCCACTTCC
TCAGCCTTTCCAGTGCTTTCTGCTTCAATAACACCAACCCCGGGGCCTTGCAATCGATCTCGCCACGGACCTGGCGGACCACCAAGTTCGAGACTCCGCA
GATCACGAGTCGTTTACGATCTACTTCTTCCAGTAGGTCCAGAGACAGCAAGAGTCCATGGTACTTTGCCTCATTGGCCGTCATGTTCGTTGCATAACCC
GATCTGGCCTTTACTACCGTCCATCCAGGG