Description :
From Genome Similarity Track
Location :
Scaffold_329:2979- 4426
Transcript NameFunction/comments
Aphas_H257_19348Hypothetical protein

Sequence
1447 bases(100 bases per row)
AAAAGACGCTCGGCTATGTTTAACGTTGGGGTGACAGCACCAAGGAGGACATATGTGTCATTCTCGTTGGCCAGGCGCGCACGTTTCAACACCCTTACGG
CAAATCTAGCCTCTTCGTCCAAGGCATTGTCTGCGCCTTAGTTGCTTCGCAGTGCAGCAACGGCCAACTTCTCTGGCCGAGTGAGCATGAGACCACGTTG
AAGTTTCGTGATGGTATTTCAAAATTTGGGTTACCGCAATATTTGCTGATCCACCTAATATATTCCAAGTCTACTTGAAATATTTCATATATACACCTCA
TGAAACTTTGTAACAATGTAATGCTCAAAGCTGGGGAAGTCAACGACAAGAGCATCAAAGAGAGTTCGAACCTGCCACATTACAGGGTCGGTAGACTGCA
AACTCGCTTTGACACGGATTCTACCTTCTTCAAATCTTCCAGGAGACATTTCAACTTCTTCGTTTCACCAAGCGTTCATAGAATTTCCAAAATAGTGTTG
TCCTCGTGGTCGAGATATTCTCGAAGCTCGAAAAATCGCTGAAGCATGGCAAACGTCGAACTCTAACGAGTGTCTTGGTGGAGAATTGGTCGTAGCTCTG
TCCGAAACCTACGATTTCAAATATACAATTTAGAAATTGAAAATAAATATGATAAATTATATTAAACAATAAAATAGACTTACAGGAGTTTGGAGGCCTG
GTTGAGTGTTCGCAGCTTGATCATCAGCTGTTGTATCTTGGCGAGCTCATCCACATGCTCCTGCGTGTACGCCTTGACCGCAAGATTCAATCGGTGGCTG
GCGCAGCCAATCAACGACACGGACATAAGCGCGGCTAACTTGTTGACGCCGCAGTTGTCGCCCACAAAGAAGACACATTGCTTAATGGCCTTCTTGTACA
AGGCCAAGAACGACTTGATCGCAGTGTAGTGCGTCTTCGCACTGTGGTCGTCATCCGGCTCGTGGATGATGGTCGTCAGCGACAGGAGCTGCTGCACATG
GACTCCATCCTATTCATACGACCCAAACACTGCAACGTAGTGCTCGGAGTTATGGGTCCAACCGTCGAAAACAATGCCAAACGATCCGGAGTTTCTTTCG
AAATATATTTTTCGACGACTTCAGTAAGCCGTAAAATGTTGTCGCGAAGGGTACAAGAGAAATAGTCGGCAAATTCGTAATTCTAAAAAATTATGTTTGA
GCTGTGTATGTTCAAAAATCATAATCGGTACAGGTCAACGAATCATATTCCATACCATAACGACTCGGACGTGACGTGAAAACCATTCGGACAGAGCTTC
AGACACAGAAATATTTGAGGAATTAATACAATTGCTGCATACAAATTCCAAGCTTGCTTCACGTAATTAAAATAACGATGATAGGATAAGTACAGCGTAA
CTAGAGACTGCACATCAACGACAACCGCAAGTCCTTACTACTACTCT