Description :
From Genome Similarity Track
Location :
contig_97:29787- 30948
Transcript NameFunction/comments
g13348.t1hypothetical protein

Sequence
1161 bases(100 bases per row)
CAAACAGGCTCAGTGTTGATTCCCTGATGACTGGCAACTCCACGTCGAACAACTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCAT
GTGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGACCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTTC
ATTACAGGATCTTCGTGCAGGAACTTGTAAAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGG
CTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCGAGGTTGCGAGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTC
GGTTTTCACCGTCGGACCTTCGTCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCT
AGGTCCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCTCCCAGCACTCTCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATC
CATCTTCCGTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTGACATCTTCTTCGGTGGACTCACGGTGAAATCCCTGAGAGTCACCAGAAGATCCGGG
CACGCGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGACGCGATCCGAACTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTC
CGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCGGAAGATGTCAGTGGGTG
ACCAAGGCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGTGGGTGACGGCCACGCGGGTATCCTTCACGCGGTCGTCGGTGTTGGTGATCGGGT
CTTGGGACAAGTCGATCACGTGGGGGGTGTCCTTGGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATG
AGAGTAGACGATCGCACCCTGGCCAAGCTATCCAGGTCTGCGTCGTGTCCTTGGTCGACTG