Description :
From Genome Similarity Track
Location :
Scaffold_177:29786- 31395
Transcript NameFunction/comments
Phyag_g3117hypothetical protein PHYSODRAFT_467093
Phyag_g3118conserved hypothetical protein

Sequence
1609 bases(100 bases per row)
CCGCTTCTAATGCTAGCAGTAGTCATCGAAATGGATTCGAGCTCTACGGATTCGATGTGCTgcttgaaggtgaagaaaTGAAGCCTCGTCTTCTGGAGGT
GAACGTGTTCCCGTCcctcagcagctcgtcacCAATGGACAAACGCATCAAAACTGTTCTCGTCAGCGATTTGTTCCAGCTCGTGGGCATCCCGTTCGTA
GACGCACGAAGGGaagtgcagcaactcgaTAAATTCAAGCAAGACCGACTCCACGGAATCACACAGACTCGCCAATCAGATGCAGGGGCAACCACCACAG
CTATCAGGAAAGAAAAGTATGtgcagcaacggcgacgCACGCTCGAGGGTCTGCAAGGATCCACTGGTAGCGTGACGATGGCCCAGATTAACGGTGAAGA
CCTGCAGCTTGTGAAAaagatggaggaagagctgcaccGCCAAGGCCACTTCAAGCGCATTTTTCCCACCTCCCAGTCGTTCGACAAGTATTCCGCGCTC
TTCGATAATCTGCGCTATCGCAACCTACTTTGCATgaggtggctgcagcacacaAACCAAGACGGCGCTCGGCGATTACCACCAACTGGGAAGAAATGAT
AGAAAATTCGCGTCTTGTTACTCGGTTTCTGCACCATTCACCGCCGCATCAGCAGGCacttccttcttctgttcCACATCGTCGATGTCTACCTTATCCG
TCCCCTCCGCCGTTGCTGCTACTTCATTCTCCACCATTCCAGCTTCCTTGGCGACACTGAATTGACTCAGCTGGTCTTCTAACTGCGAGAACTTCTGTTG
GATTTGGACGAGACTCGCTTGCACATGCGCATCCTTAGCGTCCATCTTCTTATGCAATTGGTACAGTGCCTGCTCCGAGAACGCTAAACGCTGTGACAAC
GTCGACAATTTTGCATCGATGGCTCGTGCAATtttcgtctccatctcccgctccagcgtctgctggAACCCTTTCAAAAGCATCGCCACAtccggagcag
cagcagcagcagctccacctcctccaagACCCAATCCAGCCATCTTCGCCGCCAACCCCACAGCACTACaaaaaaaacaacaacaacaaaacacCGTCAA
TCACCCAAAACCACAAATACAAAAATCTCTTTTTCTACCTCGTCTCGACTGTAGCAACAGGTTCCATAGTCACGAATTTACACTGAAACTCTTGCAAACT
CAACACACTTTTGCCCCCCATCAAGGACACGAACTTGActcgcagcgtctgcagactCTTGAGCACATCGCAGTCTTTGTCGCTCTGCTTGAATTCTGGC
GACATGGTGAACGTCTGCGTGTCTGAGACCTGTTTGGTGCCTCGGAAAGTACCCAAATACACTTCGCCCTGCTCCTCTTCGCCCAGCATGTTGCGTCTCG
TGCCGTCCACGTAAATCTCCACGTGCCGAGCGGAGCTTTGGAtctcgagctggagctggagacaGCGCAGAGGTTGTGGCGACCAGTGGAGCGACACTTG
GCACGGGACAGAGCCATCGacagctgctggtggacgagttAACTGCAGCGGAAGCGAAGACAGCGTCGCGACAccggcgctggaggcgacAGGGAGGTTG
GCATCGGAG