Description :
From Genome Similarity Track
Location :
contig_14:297850- 300150
Transcript NameFunction/comments
g2967.t1hypothetical protein

Sequence
2300 bases(100 bases per row)
AACTTTGCGAATGGTTCCAACGCGTCGTGATTGCTTGTCTCCCGCTATTCGGTACGTGACTCGCACTCCCTTTTTAAGAGGAGGCTGCTTCTCACCATCG
GATCCAGAGGATTCGGAAGAAGAGTGCCGTTTTGCCTTCTTCTTGGGTTTTGTCCTTGGTAATTCTTGGTCCGAGTCGGAGGATGGCGCAGCAGGTTTGG
AGTTTGCCTTCTTCTTGGAAGTTTGATCTTCGTGGCCGCTATCGTCGCTCCTTGCTTGGTTGCCGCCAACCTTTTTGATATTTTCAACTCGTACGCCTTT
TTCCGAAGCTCCAACGTCGTATTCGACGTCAAAGGTGCCGTCCGACCTCGCGCGTACGACTTTCCCACGATGAAACTTGCCTTTCTGCTTGAAGTTGGCC
TCGACAATGTCACCAGCTTTAATGGTTCCGCTCTCCTTACCGACGCGCTTCTTGCGCTTGCTGTCTGAATCCGAGTCTCCAAAGATGTCGTCCTTGTCGA
CACTTGCCTTTGCCTCGGGTTTCTTCGCTTTACTACCAGGAATTAACGCGATAGATGAGCTCTTCACACGTAACTCCGTGTCTCCGTCGTCGTACTCGAT
GTCAAACGTGCCATCCACTCGGGCCTTCACAATCGTACCCGGGTACGTTTTGACCCCTCCCTTGTACTTGGCATTGACCTTGTCACCCTCAGTAAAGCTT
TCAGGCTTCTTCTCCTCTGCCTTCGCTCGTGCTATGGGCTTTGCTTCCCCTTCGATGCAGGAGCGCTCAACGTACATCTCGGTGTCTCCATCCTCGTACC
TGATGTCGTACGTACCATCCGACCTCACGCGGGTGATTTTACCAGGGAACAGCTTCGCCCCCTTCTTGTAGCGCGCCTTGACGCATCACCAACCTCGAAT
TGCTTCGCTGTGGACGGTACCGGTGAGTCTGCACTCGGTTTGGACGTCTCAGGCTCAGCTGCAACGACGAGAGACGAATCTACGCGAGTTTCGGAGTCGC
CGTCTTCGTATCGGATGTCGTACGTTCCATCAGGTCGCACACGCTCAATTGTGCCCGGGAAATACTTCGCCCCCTTCTTGTACTTGGCTTGGACTGCGTC
TCCAACAGCAAACCCCGTCTTCTTCTTCTGAGAACTCTCCTCCTTTCCCTCTTGCACCTTGATTCGTGACCTCGGGACGCGTCGATCGGAGTCGCCGTCG
TCGAATGTGACGTCGTAGGTGCCATCAGAATGGACGCGAGATATCTTACCAGGAAACATCTTGACGCCGTTCTTGAAGTTGGCTTCCACCAAGTCCCCAA
CCTGCAGCGTACTGGGGCTTTTCTTCGATGGTTGTGGGTCTCTTTCGTCGTCTTCCAGCTCGATATCTGTGGCCTCCACGTCCTTCTCCTTATCGCCATC
GTCGTATCGAACATCGTACGTGCCGTCACGGTGGACAGCAGTGATCTCGCCGCGAAACATCTTGCTCCCTTTGTTGTAGCGAGCACGCACTTTGTCGCCC
AACTTCAGGCGCTGGATTGATTTAGGCGAGTCAGGTCTGTCGTCTTCTTTGCCCTTTTTGCTCTCGAGCGCTTCGATCATCTCCAAGGCGACTCGCATTT
CGACGTCTCCATCGTCGTATTTGATATCGTACGTTCCATCGCTGCGAGCTCGCGCCACCGTACCAGCAAATAGCTTCTTGCCGTTCTTGTACCTCGCCTT
CACGGCGTCTCCAACCTCCAAAGTGACCTTTTGGGGCTTTTCGTCGCGCGGAGTCGGCCCCTCTTCCGGTTGGATGCGGTCACTCGGGACACGGGTGGCT
TTGTCTCCATCGTCGAAGGTGATATCGTAAGTGCCATCGCTGCGTACACGAGAAACTTTACCTCGAAAGAGTTTGGTGCCTCCCTGAAACGGTGCTTTGA
CAACGTCGCCAACTTCTAACGATTTCTTCGCCGTCTTCTTTAACTTATCATCGTCTTCGTCGCCATCTACGCGCTGGATGAAGTCTACTTCGACGCGTTC
CTCAACATCCCCGTCCTCGTACTTGACGTCGTACGTGCCATCCATGCGCTCACGAGTGATTTTCCCTGCGAAGAGCCTTGCTCCGCCTTTGTATTTTGCC
TTCACAGCGTCGCCGACCCGAAGTGGCCGCTGCGTCGAGCTCTTCGAGCTTGTCTTCGGGCTGTCTTGTGCCTTCGTTGACCGCAGTTTGTCTGCGTCAG
TTTTATCCGACTCGGCATCTTCAATCAAGCTTGCTTCCACTCGAGCCTCCGAGTCCCCATCGTCGTACTTGACGTCGTAGGTCCCATTCATGTGAACCTT