Description :
From Genome Similarity Track
Location :
Scaffold_173:29785- 35717
Transcript NameFunction/comments
Aphas_H257_18522intraflagellar transport protein 140 putative
Aphas_H257_18523Hypothetical protein

Sequence
5932 bases(100 bases per row)
CATGGCGCTGTATTACGACTACACTGTGGAGATCCCGACGAACGCGCGACAGCTTCACTCGTCATGGAGCGAAGTAGAGTCCGTCCTTGCCGTCGCTTTC
GACAACCACGAAGTTCACTTTTTTAGCGACGAAGTACAAGGCGGTTGGGATGGTTATGATGGTTCATAATATAAACTTCTGTAGGGAGAACGACTTCAAA
CTCCAATCCACACGAGAAAGGCAGACGTGACTGCAATTGCGTGGCAGCCCCGGGGAGCAGTTCTCGCCGTGACGTGGAGCGACGGTGTGACCCTGCCAAA
CGAACGCGCATGTATCTCTTACGCGATTTGTAGGAATGCTGTCCCTGTGGATCCAGAAAGAAAACGTGGCGAGGGAGGTGAATTCGCCCCACACGAGCCG
GATCAACTTGCTCAAGTGGGCTCCAACTGGAAATCGGTTGATCACGGGCGACGAAAACGGCGTGTTGGCCGTGTGGAAGATTGACGCGAGAGGGCAAGTG
GGTCTGTGCACGCAGTACACCCGCCAGGGGAGCTTGACGCAGTGTGTGTTTTGCATTGTGCCGCAACGGCGAGACAAGGAGATCAAGAGGTATCTTATGT
CTGTGACACTGTTCCACGCTCATTGTTTCACATGTTTAGTGAAAGTCAATTTGCCATCACTGCGTGCCCTTCCTTCTTCTTTGGAGGGGATCTGGGCACC
GTGCATTATGCCGACGACTTGGGACACATCTCGGACGTTCAAACGCTCAACCACGCCATCGACTGCATGATGTTTTACGAAGAAAAGCACCGGTACGAGG
GATTACTGGGTAGTATTTGGAGGATTCAACTCATACTACATATAACAGGTTGGTGGTGATCACTCGGGCGTCCCAGCTCGTGCAGTTGCAGATCGCATCC
GATGGCACGGTGAAGCCCATCATGAAGGTCAAACTGAGTGTGTCGGGGGACGGCGGACTAAAAGAAGCGATTTGGGCTGGACCAGGTCTATCCTAGCACT
CATGACCTTTTCGTCCAACTGACTCTATTTGTTAGGGTTGCTGGCCACGGCGTCGGGGGAGCAGCTCATTCGGTTCTGGGACCTGCAAAAGGAAGAAAAC
TACGTGCTGAGCCTGGCCAACGGGGGCATCCCCCCCAGCGACCGCGTGTCGGCCGTCGACTTCAACCCTCGCAAGCGCATCCTCGCCGTGGGCACAAACG
AAGGCAAACTCGTGTTCTGGCGGCTCACGCAGGGCCAACAGTCCAAGTCCAACCAGTGGTCGCTCATGGCGGTCGCCGACATGCACCAGAGCGTGTCCAA
ACTCGGGTGGAATCCACTCTACTCGTACTTGTACGCGCACGCCCAGGGCGCGGGCGTGACCGTATTCCACGAAGCCGTGATGAACCGATCGCTGCACGAA
GACACGGCGGTGATTCAGACGCGCCCCATGTGTCTGTCGGTGGAGAAGCTTGCGGACGGCACGGTGGTTCAGACGTCCGTCGACGCGTCCATCCGGATCA
AGGGGGTGGCCCACGACGGCAATTTGATTCTCGTGTGGAACGGAACCAAGGCTGAAGTGTACGAGCTCCAGACCGACCTCGAAACCAAGCGCGTGAGCTC
GTTCAAGTGCACGTCCACCGCCATGCAGCTGCGCGGCGACGTCATTTACCGCACCCACGGTAACCACATTGAAGTGACCAACACCAGCGGCACGGTCAAA
AATACCATCTCGTTCACGGAAGCCGAAGGCCAGCCGTTTGTGATGCACATCAACAACAAGTACCTCGCCGTGGGCACGGACGCCGGCCTCATTCGCGTGT
TCGACTTGTCGAGGCGCGAACCCAAGGCGTTTGGCAGTTTGGGCGACGTCTCGGTAGGTGGTACACATGCCATCATTGTGTGAGGTGTGAGGATGGATGT
AGAAAGCGTTTGCGGGTATGAACGCAAAGTCCACGCTGCGATCGCTCAGTGTCAACTGCGATGGCACGCGCGTGAGCTTCTTGCTCTACACGGTCGAAGG
CGCGCTCAAAGTGCGCACGCCCCACACCAAGCTGTACCTGTTCAACACGGACCTGAACGCGTTCCAGTCGTTCGAATTCGGCCCCGCTCGACACCCGACG
TCGCACTTTTGGGATCCCCAAGAAGCCCGGCTCATGGCGTGTGAAACCTTCCAAGTAAACCATAAACAACTCTCTTGTATACGTTCGTGGCGGCATGCAT
CATCACTACTGTCTTTTGGGGTCCTAGGACAAGTTGGAAGACGCCAAACACATTCCAACAGCAGACGACAAATCCGACGACAAAGGGGCAGACAATAGCC
CGTCCCAACAGGCCGACCCCACGCGTCTGAGCTCGCATTCGGAGCGAGAAATCACGATTTTATTCGTGTCCAACGAGCGGGGACTGCTCATGCAAGATAA
CTTTGACCTGGATGCCAAGTACAGCGCGCTTCTGGGGATTCACGTGCCGCGCATGTACTTTGCGTCGTCGCAAGAAAGCATCAAACGCGAGACCAAGGAC
GACAGCGGCCCCGTGGCACTCCTGCGCACCAAGATCATGCAGGATTTCGTCGGGTTGGACAAAGTGGACGGGCCCACGAGACAAGCGTTGATCGACTTTT
CGTATTACATAACGATTGGCAACATGGACGAAGCGTACCGGTCTGTCAAGTTGATCCAAAATGCGTCCGTGTGGGAAAACATGGCCAACACATGTGTGAA
AACCAAGCGGCTGGACGTCGCGGAGGTGTGTCTGGGCAACATGGGGCACGCGCGGGGGGCGGCGGCCGTTCACGGCGCCAAGTTGGAAAACCCCGAGATC
GAAGCCCCGATTGCGATGGTCGCGATCCAGTTGGGCTTGTTGGACGACGCTGCCCGGCTGTACAAAGAGTGTGGCCGCTTCGACCTGCTCAACAAACTGT
ACCAGTCGGCCGGGTACTGGTCCAAAGCCATCGAAGTCGCTACCAAACGCGACCGCATTCACCTCAAGACGACGCATTTCGCCTACGCCAAGCACTTGGA
AGAAGAAGGTAACTTAAAAGAGGCCATTCGACAGTACGAGCTGGCGGGCACGGCGGCCAAGGACGTCCCGCGCATGCTTTTCAGTCGCGGCAAGCTGGAG
ATGCTCAACAGCTACGCGTCCAAGTCAGAAGACCCGCGCCTGCTGCTGTGGTGGGCGCAGTACCAGGAAAGCAACCAAGAATTCGACTCGGCGATTGCGT
CGTACCGTCGCGCCAAGGACTACTTGTCCCTCGTGCGAGTACTCTGCCACAAAAAGGACTTTGACCAGGCGGCGCAAGTCGTGATTTCGAAAAACAACAA
GGCCGCTGCCTACCACCTCGCTCGGCAGTACGAAGCCAACGACAACATCGCCGGTGCCATCCAATTCTACGCGACCAGCGGCTCGTACAACCACGCGATT
CGCCTATCGCGTGAATTCAACCTGGACGGGGACCTGATGAACTATGCGCTGCTAAGCAAGCCAGGACCGATGCTCGAGTGCGCGCAGTACTTTGAAACCA
AGCGCGAGTTTGAAAAGGCCGTGGTGCTGTACCACAAGGGCGGCCACGTGTCCAAGGCTCTCGAGATTTGCTTCCAAGCCAACCTATTTGACGAACTGCA
CACGATCGCCGATGAACTGGGCTCGTCCACCAACACGTCGCCCATCGTGCTGGGCAAATGCGCCGACTTCTTCGCCAAGAATGGCCAACACGCCAAAGCT
GTGCCGCTGCTCATCCGCGGCAACCGCATCGCAGACGCCCTCGAGATTTGCATCCAGCACAAGGTGAAAATCACGGAAGAGATGGCGGACCTGCTGACGC
CTGCGAAACCGTCAGACGAAACCGACAAAATCGCGGCGAAACGCCGCGTGGACCTCATGATGAAGTTGGCAAAATGCTGCAAGCACCAAGGCGCGTTCCA
CTTGGCGACCAAAAAGTACACCCAAGCGGGGGCGAAATTGAAAGCCATGAAGTGCCTGCTCAAGTCTGGGGACACAGAAAAGGTGATTTTCTTTGCCAAC
GTGTCGCGCAACAACGAGATATTCATCCTGGCCGCCAACTACCTTCAAAACTTGGACTGGCGGAACGACCCCGATATCTCAAAGAACGTCGTGGGGTTTT
ACTCCAAGGCCAAAGCGTTTGACCAACTGGCGGGGTTCTACGACGCGTGTGCCCAAGTCGAAATCGACGACTACAAAGACTACGCCAAGGCCAAGCGGTC
GCTGGAAGACGCGATGAAAGTGGCCGCCAAGTCCACCGGGCCAGGCAAAGACAAGAAAGTCGCGTCGTTCGAGCAACGCATTGCCGTTGTGGACAAGTTC
ATGACGGCGAAATCCCTGGCCAAGACCGATCCGAACGAAATGGTGGCGTTGTTGCAACAGCTCCTCGAGGACGCCGACGTGGACTCGGCGATTCGCAGTG
GTGACGCCTTTGCGCTGCTTGTCACGCATGCGTACGAAAGCGACGACGTCCAGCATGCCGTGGAGCTCATCAATGCTATGCGCCAGCGCAACATCTCGGT
CAAGGCATTCATCAACCAGAAAATGCTGAATGAAATCCAAGCAAAGGCCGGTGGAAGTGGTAGCGCCACGGACTCGACGCCAGAACGAAGCGACACGCGA
TCATCGGTGGCCAAACAGAGTCAGGAAGCCAAGGGAGGTGATGAAGACGAAGACATGCAAGAAGACATTGAAGAGGAAGAAGGCAGCCCCCCGCGTCGAA
AGTAGCGTTTTCATAGTACATTACTATGTAGTTGTCGATTCAATACGTCTAGTTTATCGTAACTCCATGCCGATTTGACATAGCGTGCAAATACATCACC
ACAATCGATACAGTGCGATGTGCCACACATGAACACTAGTAACCCTTTCGTACCTGTCTGGCATATTTGAAGTCAGAGTGTAACTGCCACCTTGAAGCGT
TTCACTTTATACTGCATTGTGGCTTTGCAACTATGCAGAGGCAATGGGAAGATGAAATCGTTCAATACCTGGACAAGTGCTCCGTGTCTCAGTATGCGAC
ACCGTATTTGACGTGCTGCGTGTGCAATTGCATAAACTTCATCGACGTACCGAGCATCCGCGGCCTCCAGAGCAGGGCCAAGGGGGGCTCGTCCGTGTTC
GAGTCGCTGCCCCCGTGTTGTGGATGTGGTCGCACGCGGCATTTGCGCACGGGGGCCACGAGTTTCCATGCCGAGATCGCACTGGAGACCCAGGCGGTGG
AGGACTTTCAAAAGAAGCGCGTGCCTGCCGCCATCGACATGCAGGTGCGAGTTCATGCCTGCATCCTGTCAACACCCCCCCCTCGTCTCCATTTGCATGC
TGAAGCTCAACTCATGGACTTAGCGCGTCGTGCGCGGACGACTCGGGCGTCTTGAGGCGAAGCGCCGCCGCCTAGAGAGAGAGCGCTATGCTCGAAAGAT
CTTCAACGCCGCCGCATGCATCCAAAAACGAGTGCGTGGCATCCAAGCGCGCACAAGGAGCGACATCGAAAGATGCATATTTATCATTGTGGTATTACTG
AACTCGCATCCCATCTCCAGCAACTGGCTAACGTCATCTCTGACCACAAACGTAGAACGCCCACCCGCTCGTTTACGCGTACGCCACAACCACGACGACC
TCCACCACCTCCTCCTCAAGCAGCCAGCAGCCACCCCCCGTCGTCGAAACCGTGTTTTGGTACGACAGTGCCGAAGAGTTTGGCGTGTTTTGCTGGGACT
ACAGGGAGTTTGTTCGTCGCACGGGGGGACGGCCACCTCTGTGGCGGGTCGAAGCCAACGTCCGCGAAGTGACGAGGCGCATCTTGAATCGAGAATATGT
GCTTGTGACGCGCCTTCAAGCGCGGTGGCGAGGCATCACCGCGCGCAGCTCTATCTACGAGCTAAAAAAACAAGTTGGATGGCTGCGCAGTTTGCGTCAC
TCCCCCGCCATCCGAATCCAGCGCCAGCTTCG