Description :
From Genome Similarity Track
Location :
Scaffold_18:297843- 298924
Transcript NameFunction/comments
Aphas_H257_08244cell division protein ftsZ

Sequence
1081 bases(100 bases per row)
ATCGAGGGAACGAAAGAGAGAGCTGGTTTGTACCGGAAAGCATCCATGAGCGACGTCTGGTCGGTGGACATGTTGAACAGGTTTTGGTTGGGGATAACGA
TCATCGTGTCCACGCTCTGTTTGAGCTCGTGCAGCCCCTGGTCGGCCAGCTTCATGCGATGGCTGCCTTCGAAGCGGAACGGCTACATGTCATACAACAC
TGTCAGCAACTTGCTCGAGAACGACGACCAATCGACCTTGGTGACCACGCCGACGGTCAAGATGCCCGAATCCAACGCGGCTTGCGCGATCACGGGCGCG
GCCCCTGTCCCCGTGCCACCGCCCATCCCCGCCGTTACAAACATCTACCTCCCATGTATTGCATTCAGAACAAAATACAGCTTGGAACAAGTCGAACCAT
GTTGGCGTTGCCAATGCGCTCCATGATCTCGTCCAAGCTAGCTTCCGCCGCCAATCGACTGAAACAACATGGTGATGATTATTGTGATGCATTCTATATG
ACACCATCGGGGTATGAGGTTACCCTGCGTCGGGGTTGGCGCCGCAGCCGAGCCCTCCCGTGAGCTCGGACCCCATCTGGATGCGATTGTCGGTGAGAGT
CGTCTTCAGGTGCTGCGCATCCGTGTTGCACACGAGGAAGTCGACGCCATGCAACCCGCGCGCAATCATGTTGTTGACTAGTGGTCGATTCATGTATCAG
TCAAGGAAGTACCCATAAGATTCGTGAGGAAAGAGAAAGGGCGTACCAGCATTCCCGCCGGCACCGCCGACGCCCACGACGATGATTTTCGGCGCGAACG
AGTTTACATGCGTCTCATGGAGGTGATCCAGCCATGGATGGGGTGATGTCGTTGCGGCTTCCTCCGCCTCGGGGCCAACCACGTTGGATGGAACGTACAA
ATTGTCATCATGCGTGACGTCGTCGTCCTTTTGGCTCTTGGAAAAGCCCTGGGAGGAGCACATGTTTTGTTACCCAAGTAGAAGAGTTGGCATGAACATG
CATACCTTTTGGAGAGATGCAGCCGCAGCGTCGGCGGCTGATGTGGACAGTGCGCGGACGTGGCGCAAGCTCTGGAAGGTC