Description :
From Genome Similarity Track
Location :
Scaffold_38:2978- 7823
Transcript NameFunction/comments
Albla_Nc14037710putative RNA helicase

Sequence
4845 bases(100 bases per row)
TCTACCACCGCTGGAATCCACCGCGACCACCTCCTCGTCCACCTCGGCCACGACCACCACGACCGCCTCCGCCACTACCGATCAAGCTGCGTAATGCAGC
TGGAACTTGTTGATTGGCTTCTTCCAGAACTCGAATGAGAGGACTCGCGAGACGTCCATTATCTGAGGTGAAAAAGGAAATGGCTGTTCCTTTGCTTCCA
GCACGTGCTGTACGTCCGATTCGATGGATGTAATCTTCGACGTTCTTGGGCATGTCGAAGTTGATCACATAGCGGATATCTTTGATATCCAAACCACGAG
AGGCCACATCGGTAGCGACAAGAATCTGAGTTTTGCCTTGCTTGAAATCTTTCAAGACATAATCACGTTCTTCTTGCGACTTATTTCCATGAATCGCTTT
GCAGATATACCGACTGTTTCGAAGATTTCGGCTGAGTTCATCTGCGCCTCGTTTTGTTTCGCAAAATAAAATGATGCGACCTCCGTCGTAGATCACTCGA
AGGTGGGCCACTAACGCATTGTATTTTTGATGATCGTCCATCACCTCGACAATTTGTTCGATCTTTTTATTGGCGGTCAGTTCTAAAGACCCCACAGTGA
CTTGGATGTAATCAGTTAGAAAGTCATGAGCGAGTGACACGATCTCTTTCGGCCAGGTAGCAGACCACATGAGCGTTTGTCTGTCTGGTCTGATTTGAGA
GACGATCTTGCGAAGTTGAGGCTCAAATCCCATGTCAAGCATTCTATCGGCTTCATCCAGTACGAGGTACGTCACACGACGAAGATTAGTTTTCCCTTGA
CTGAGCAAATCAATCATTCGTCCGGGTGTACTAGTACAAAAAATTATAGTGAGAATGTGATCTGAGCAGACAACAGCAACTTTCGTACCAGATACAAATT
TCGACTCCTTGACGCAGCTCCATGATCTGATTGTATTTTGGAACACCTCCGTAGACGCAAGTATTCTTGATCTTTGAACTAGCTCCGAATTTGTTTGCTT
CTTGTTGGATTTGCACCGCCAATTCGCGAGTTGGTGCAATGATGAGCACAATTGGACCATCACCCGGTTCAAGGTGTGGCTAGATACAAATTGCCCGACA
GACAGAGACACAAAACATCAGGTAACCATGAAATTGGAGTTGCATAACGTAAAGCTGCTGGACGAAATAATCATAGAGAGTAGCCGAGATTACTTGGTCA
ACCAGCAACAAAACGCTAGAGACTATCCTCACGCTGAGTGGAGGTACGATGTACGATACAACGAAGCTGGTGATGGAAGATGAACCAAGGTGTGTCCTCA
CGAAGCACTTATGATACTCCAATGAGATCAGGCACAGTGGATACAGTAAGAGCTTGTAGACACCGACATTTTCAAGTTCGAACATCGCTGAGAGTCATTT
ATACTCAGAGTACAGATGTTCTTCCTTGAAAAGTGAAATGTGTGGGTGCAAAGCTCATGTCCGTAAATATCACACCTCGTAAGCATCAATTCCTCGACAC
AAGCATCATAGACCGGCAATCATACCCTCCATGATTATTTCAAGCCCCATGTTTTCACAAACTGGCGCCCAGAGACCAGCAGCAATTCGATATAGAGTTC
ATGTAGTATGAATAATTCCACAAACCTGTGCATTGATGTGTACTATAGCCGGCAGTAAGAAAGCCAAGGTCTTCCCAGATCCTGTAGCAGAGATTCCAAC
CATATCCCTTCCGGACAAAGCCATAGGCCATCCCTGACATTGAATGGGAGTTGGCTTCTGGAATCCCAGTCTCATGACTTCTTCCAAGACATACGCTATT
TTCAAAAGGTTAATACAAGCCAGAGACAATCTCGCAAACAGCAATCTCACCGGGAAAGGAAGCTTCTTCAAACGTATAAACGCATCTGGGAATATTCTTT
CCGTGTGTTGTTATGTCATGCTCTTGTTTCCAGCGTTCCAATTCCTTTTCAGTTCGTCGAGCAACTTCGGGATGCTCGTAATAAAAGTTCTTTTCAAAAA
CCGGTAATTTCGCCATGTTCCACTGAATGTTTGAATCTAATTCTGCACCCAGACTTCCCATTCCACCACCACCTCCTCTTGAATCTCCGTATCCATTGGA
ACCATACCCCGAGCTATTTCCTTGTCGACTCGAACTGTAGCCTCCACCTCCACCATAACCTCCGCTGCTTCCTCCTGAGCGATTACCAGATCCGCTGTAG
CCGCCTCCGGATTCAGAGTAACGTGAAGATGAATTATCATTCGATGTATACGAACGACGCGATGATTGATCGCCGCGACGGTCTTGCCAACTCGATGAAG
ATCCGCCGTACATTGAGTCTTTCCTCTTTGAAATGCGGAAAAGTCGGGAATGTGTGTTGAGGTTTTATTGTGCCTGTGGGTTTTAAATTAATGGTAGACA
TTGAAATAAAATATGGTTGGTTATAAATGATCGCGTTTTCATCCAATAGAAATTAGCTGAGTATGGTTCTTTCGTAAGAAGCAAGTTGCATGTGGGCTTC
TGAGATGCTCACTTCAATTTTCTTCACTCCGCGTTGCTACGAGTAAAACAATTAAGAGCGAGATGACAAATTGGTAAAGGAAGATGCACTTGCCAATAAT
GCCACCAGTGTGAAGGCGTCAATAAGCTGATTACTCTATCAAATACATAAGAGATATAGTTTCCGATCCAACACTATGAGGCCAAGCACTTACAAAATAG
ATCGCTAATTCTTCTGCTGAAGAGTGGACTATGGGCAAAAGCGAGCAATCGGATTTTGGGAAGCTATGATAAATATCAGACTGAAACCCTGGACCATTTT
CTACGCAAGAATACAACAATGTCACCTGAATTTTGCATTGTCTTCTGTCAATATGTGTACATTTGTTCCATCAAATGTGATCTACAAAACACAACCGCGA
TTTTAGATTTGACCAAATTATAAAGAGGCTTTTGTACTTTTAAGACATCGCTGTTCATAGGTACCAAAAATGATTCGTCCAGATCTTTGCTAATGACTCG
GGAAATCTTCTTGATTTCGCCAAAGTCTAAGACGTAGCCATCAGGTCCCACAACTCCAGTCAGTGTCACTGCAACTCGATAATTATGTCCATGTAGTTTC
TCTCGATATCCCTAGCACAAAAAATGAATGCATCGGTTGGCTCAGTGTTCTCTAATCATCTCTTACTTTGTATGCGATAAAGTGAGCCGCATTAAATTTC
ATGTAATCTTTGGCAACATGGACCTTGAACACTTCATTGTATCCCGTTGTTAGAGCATTTTGTAAATTTCCAAGATGATTGGTGCTTGTACTATGCTGAA
GTGAGTTTTGTGGTACATTGGCAGCACTAAGAGCAGCTGAAATGATATTCGCATGTGCGTTTACAACCGTTCTAAAAGGCTGAATCTGTCCTTTTACATC
TTCCGGTGTTTTACCACACCCACGTAAATGAGAAGCCCATCGATCCACGTTTTTTGAAGTGATTTCTTTGTTGCAATAATTACATTTCACAAACCCTTCG
GATGTAGCTTCTCTGGAAACATGAAGTTTTACAATAGCTTTCTGTTCGGGGCTGAGTTCTTTCGTCATTGTTGAGAATTTACGTTTCTTTCTTGATAGAT
CGTCTGATGAGGAGTGATTATGATGGTGTTCGTCAATCTCAGTTGGAGTCACAGCGTCAGGTATTTCGGCTTTTTCGACTACGCTATTGGCATCGTCCGA
TAATGCTCGCAACATGTATTCCACACAATATTCACTTCACATTAGTGAAAGCGGACATAACAACCAATTAAAAAAAAGTGTGGGTACAGCAGCGTCCATA
CTGAATGGACAATAAGCTTACACTATAATTAAGTGAACTACTCTATCTCGAGCACCTCCTGGCGCCTATGTTGCCATTACTTTTGGCACAACACTCAAAA
CGAAGTTGACGCCAACGCCCGACAGCAGCCCTATCTTTTGCTTTCGAGGAACGGAACGATCCAAAAGCTACAAGAGCAATGTTAATACTTCTAACTGCGG
AGTCTTCTGATAAGTTGCGTACCATCAGCAGCATAAAAACCCCAAGTAAAAGTCCCATTAAGAATCCCCAAAGAAATTCTGTTCCGGTCCCTTCATTATC
AGCTGCCAAAATCGATCCTCCAAGACCAGTCATGTCAATTTGATGTTCCAACGCGATACGAGCCGATGGCATAACATTGAGAGCTACAGATGTACCGCTC
AAATTCTGCTGAGAATGATGATCATAAGAATATCTCACCAAACTCAGACTGAGGACCCTGTGTGTTCATCCATTCTTCTTCTAACCGATAAATTCGATCC
TCGCTATTCTCATTTTCAACATTCTCAGCTTGACGGATAAATGCAGAGATCTGAGGATAGAAGTATAATCGAAGAGCTTGAACTTCGTCTCGACTCATTC
GATCACGAAGACGATCAAATCCTCGACGATTCTGATCATCCCGTTCTTCTTGCACATTACCACCAAGATGAAGCTATAAAGCCCATCAGAGAAGCACAAT
TTGTCAGTTCCGAGTCACAATCGTGTCAGAAGACATGATACCTGGTGAACGAGTGCTTTTGGTGGTGTCGAGCTAACAGCGCAATGGATGAAATCTCCCG
AATTGATCTTGTAAGACTGGATAGACGACTTATCATCAGCTAAGATTTTCCCCTTCAGCAAAACATTAGATGAGATACGAGATTCACATTGCAATGGAAC
ACACATGATGAATCAATCGAAGGAATCTGCCATCTGCATTCACACGAACTTTGATGATTTGCTTGAGTTCTCCAACCATTGCTGTGTGCAGTATTTCGAC
TTCTAACGGCTTTTCACTCAGTGTCTTGATTTTGAGCAGTACTTT