Description :
From Genome Similarity Track
Location :
Scaffold_57:297778- 298837
Transcript NameFunction/comments
Phyra_81237PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1059 bases(100 bases per row)
GTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGAATG
GCACGGTGGCTGTCATTCTTTGCTGATTACAACTCCCAGGTTGAGTACAAACCTGGAAGGTTAAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATT
ATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCCTTGCTGGATGTCGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGG
AGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTA
CAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCACGATGCCCCGACATCGGGA
CATCCTGGCCGTGAGAAGACATACTTGCTTCTCGCGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTAT
GCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTCGTTTTTGG
TTTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCC
AAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGT
GTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATG
AAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGC