Description :
From Genome Similarity Track
Location :
contig_97:29774- 30935
Transcript NameFunction/comments
g12831.t1hypothetical protein

Sequence
1161 bases(100 bases per row)
GTACGTTGAACCGGGACGACGCTACCGACAAGGGGCGTCAGTTTCGCAAACAGGTTCAGCGTTGATTCCCTGATGATTGGTAGTTCCAAGTCGAATATCT
CGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCATACGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTT
CACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTTCATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAAAAGAAGGCAGAC
TCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCG
AGGTTGCGTGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGAACCTTCGTCCGGCGGATCACGATTCGCATCGTGATCCGC
GGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCTCCCAGCACTC
TCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATCCATCTTCCTTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTGACATCTTCTT
CTGTGGACTCACGGTGAAATCCCTGTGAATCACCAGAAGATCCAGGCACGCGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGACGCGATCCGAA
CTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCG
GGGCGGGTTACGCTCTTCCGGTGTTCTCGGAAGATGTCAGTGGGTGACCAAGGCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGTGGGTGACG
GCCACGCGGGTATCCTTCACGCGGTCGTCGGTGGTTGGTGATCGGGTCTTGGGCCAAGTCGATCACGTGGGGGGTGTCCTTGGGGTGTGCTGTTATAGCC
CTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGAGTAGACGATCG