Description :
From Genome Similarity Track
Location :
contig_97:29765- 30767
Transcript NameFunction/comments
g12831.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
GTTGGTCTTGTACGTTGAACCGGGACGACGCTACCGACAAGGGGCGTCAGTTTCGCAAACAGGTTCAGCGTTGATTCCCTGATGATTGGTAGTTCCAAGT
CGAATATCTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCATACGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTT
CGGTGCCTTCACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTTCATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAAAAG
AAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACT
TCTTCTTCGAGGTTGCGTGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGAACCTTCGTCCGGCGGATCACGATTCGCATC
GTGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCTC
CCAGCACTCTCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATCCATCTTCCTTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTGA
CATCTTCTTCTGTGGACTCACGGTGAAATCCCTGTGAATCACCAGAAGATCCAGGCACGCGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGACG
CGATCCGAACTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTAC
CCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCGGAAGATGTCAGTGGGTGACCAAGGCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGG
TG