Description :
From Genome Similarity Track
Location :
contig_97:29764- 30937
Transcript NameFunction/comments
g12831.t1hypothetical protein

Sequence
1173 bases(100 bases per row)
TGTTGGTCTTGTACGTTGAACCGGGACGACGCTACCGACAAGGGGCGTCAGTTTCGCAAACAGGTTCAGCGTTGATTCCCTGATGATTGGTAGTTCCAAG
TCGAATATCTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCATACGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCT
TCGGTGCCTTCACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTTCATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAAAA
GAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGAC
TTCTTCTTCGAGGTTGCGTGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGAACCTTCGTCCGGCGGATCACGATTCGCAT
CGTGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCT
CCCAGCACTCTCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATCCATCTTCCTTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTG
ACATCTTCTTCTGTGGACTCACGGTGAAATCCCTGTGAATCACCAGAAGATCCAGGCACGCGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGAC
GCGATCCGAACTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTA
CCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCGGAAGATGTCAGTGGGTGACCAAGGCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGG
GTGGGTGACGGCCACGCGGGTATCCTTCACGCGGTCGTCGGTGGTTGGTGATCGGGTCTTGGGCCAAGTCGATCACGTGGGGGGTGTCCTTGGGGTGTGC
TGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGAGTAGACGATCGCA