Description :
From Genome Similarity Track
Location :
Scaffold_21:297639- 302892
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008204Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
5253 bases(100 bases per row)
GTAAGGCTTTAGTCTACCCACATAAAATGTAGGATGTAGACGCATGCGTGTAGGTATGTCTAGTGTGTAGGCATCATCATTGCATTTAACTACCCTGAAC
GGTCCAATATATCTTGGCAAAAGTTTCGAACTTCCCAAGTTGGACACTGCATGTTCAGGCAGATTAGCCGTGCTAAGCAATACAAGATCGTTGACCTTAT
ATACTTGCTTGTTCTTCCTTCCACTCTTATCTGCTTGTTCCTTTTGCAGATCCTGAGCTTTTGCAATTGCGTCTCGAACAAACCTTACAATGGCTTGTCT
TCTCACAATAAAGTCGTCGACTTGCTGTGCCTCACGACTTGTCATGTCGTTTAGAGGTTTCATCGAGTCGAAATTGGCTTTCAACTCGGCAACAGCATTC
AGGTCAGTGACTGACTGCGGCTTATTTCCAAGAGCCGTAGTCCCTCCCCCACTCAAGGTAGAGACCTCACCCATTATGGAAGCAGGCACTCGGGGATGAA
TGCCGTAGTTCACATAAAATGGAGAGTGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAATTCGCTCCACTCTCCGAA
AGATGTTGCATAGCTGCGCAATACATCTTCCAGGACACGATTCACTCGTTCAGTTTGACCATCCGTTTCCGGGTGTGCTGCTGTTGACATGGACAACTTG
GTGTCCAGAAGTCTGAACAGTGCACGCCAAAACTTGGATGTGAAACGAGTGTCACGGTCAGACACGATCTCGACTGGTAGGCCATGTAGACGGAAAACAA
CGTCTACAAAGACCTTGGCCGTCATTTCGGCTGAGATCTTGTCCGAAACCGGTGCAAGATGGACCATCTTACTGAATCGGTCCACAAACACAAGGATGCC
ATTGCGTCCGTGTTTGTCACGAGGAAGTCCGAATATGAAATCCATACTCACAGACTCCCAACTGTCCGATGGGACAGCCAATGAACGAAGTGGGGCTTGC
GTGGAGCCAGATGGCTTCACACGCTGGCAGATCTCGCAAGTTCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGGGAAAGAC
TGAGAAACGTTTTCTCACGTCCGAGATGGCCACCCGAAGGACTGTCATGGTACTCATACAAGAGTCGATGACGTAAACCTTCATCGTTGGGAACAACAAC
TCGTGCTGTATCCTCAACTTCCACCGCATAATACAACAACCCATTGTGTACTCGGAAGCGGTGAACGCGCGATCTTGTTCTAGCAGGCAAGCTCTGCAGT
GCCTTGTCAGAAGGGTCTTTGAAGTACTTCAACAAGTCCTGACAAGTTTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTCGTAGCTT
GAACTGCGGCCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGCCCATATTTTCACTCTTGGACTTTGGATCGTAATCCGGACGTCTTGATAATGCGTC
GGCTAAGATGTTCGTTTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCAGCAAAGAAGGAGAACCATCTCGCCATTCTTTGCGACAAGTGAGGAGTC
TTTACTGCTGTCCGCAGCGACGCATGATCTGTATAGATTGCAAAGCGCTCTTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTCATTGCCA
GTAGCTCCTTGTCGTGAACTGGATAGTTCCGTTCTGCGGGTCGGAGTTGTCGTGATTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTGTTGCAT
CAATGCGCAACCGATGGCATAATCGCTCGCATCACAGACGACGTGGAACGGCTTGTCGTGATTCGGTAGAGCCAACACAGGAGCTTCACGAAGACTCCTC
TTGACTTCTTCGAACGCCGTTTGATGGTCTTTCGACCACTTCCACTCAACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACCAACGCTGCATAATTGC
GCGTGTACTTGTGCAAATAGTTGGCCAGACCCAACCATTGGCGTAGCTGTTTTACGTTCTGAGGCACAGGCCAATCGTCAATAGCTTTGACCTTCTCCGG
ATCAACTCGAACACCGTTCTTGCCCACAAAACATCCGAGAACAGGGATCTCGGGGGCGAAGAACATGCACTTCTTCAAGTTTGCGTAAAGTTTGTTTTCA
CGCATGACCTGGAAAACTTGACGAAGATGATCAAGATGAACATCGACATCAGATCTCCCATTTGTGGCCTTACTATGAACGAAGATATCGTCGAAGTAAC
TCGGTGCAAATGTTCGTAAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCGGGTGCATTCTTCAGTCCCTGTGGCATCACTAACCATTCCCA
CAGCATACCGCTAGGGGTACTCACTGCAGTTAGTGGGACATCGTCTTTGCGCATTCGAATCTGATAGAATCCATCTTTCAGATCGATAGCACTAAAGACG
GTGCTGCCAACCATCCCATCAAGGATCATATCCTTGCGTGGAACCGGAGTCTGAGCAGGAATAGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAACAATGC
GCCATCCGCCAGTCGCCTTCTTCACACAAAAAGTGGGGCTACAATGTGGAGACTTGCTCCCCCGCACATGCCCAGCCTTCGCGCGTTGCGCAAAGAACTC
GTCAATTGCCTCGACTTGTTCCTTTGGCAACGGCCACTGTCGTGTGATACAGTACTTCGTGCCAGGAAGTACGTCAATCTCGTGACGAATGCCTCTATCA
AATGGCAGTTCGTCCGGCACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGTTCATCTTGAGAGCATCCCACGACTGCTCCT
CGAACCTTTCCTTCCGTGTCTTTTCATCGAGCACTTCGGCTTCCGTTGCTGATACCGTGCCGATGTCCTCTGCATCGTCAACATCGACGATCATGCAGAT
CTGCGAGATTTCGCCTCTCGTTAGGCTACGCTTCAGCGTCTTCTTGCTCATCCATGGCAAGGAAATCAATTCTTCGACTGAACTTGGGGGATTTTCAATC
TTCATGTGATGGATTACATCGACGTCACCATCTTCGTTCGAAACCAGAACGTTCACAAACTCGCTTGAAATGTCTTGTGCTTGGACACTTCCTTCGTCAT
CTTGACTTGTACCTTGATCAGGGGCACTCAAAATTCTTGGCGGAACACTCTTCTTGCTGGTCTTCTTCTTCTTGTCTTGGGATGGGTCTCTGCCTCTTTT
CCCGTCGTTCTTCACACTACCATCGCACGCAACTCTGTCGTCGATGGCAAAGGAGACAGTCTTTTTATGGCGCCTGACTGCTCCACCTCCGTTCGTCTTC
TTCAAAATGGGTGCCGCTTGTGAGCATGGGGGGCCATCGCACACCGCAATATCACAAGGGCCATCTGGGACTTCTTCCACAGATGTATAAACCCATACCA
CTTCATCCGTTGCCATGCAGCTCAAGTCGGCGATGCACGACTTGTCAACGGAGATCTTCATCTTCATCCAGTCAATGCTAGGTTGGTAACGCTTCAACCA
TGGCATGCCCAGGATGATATCAAACTTGTCATCGAGGTCGAGTAAAATGAACTCGTCTTCACCTCGGAAATCTTCATACTTCATTGCCAAGCGAACAACT
CGCTTTGGCATCTTCACAGTTGACCCGTTGGCCAACCAAACAATCATCATCTTCTCTTCATTCGCAACAGGCACAGAGATGTTGTGCCTGGTGATCACTT
CATTTCGAACAAAGTTGTTCGACGCACCAGTGTCAACTAAAGCACGTAGAGGCGTTGCAATACCGTCTACATGAACTTTGAGAACGATCAAACTTGACGT
TTGACTGACACTGCTCTCACTCGTGGAAACTGCATGTGCATCATGCACATTGGGGCCAGAGTCCTGTGTTTCCACAACATCCACAGTCCTCTTCTCGAGC
CCAGTAGGAGGCCCCGCCCCTACTGGTCGTTCCCGTTTTTTGACCTTTGGGAACGATCGAACCGACGACCATTACTACGGCCGTAGTTGTTCGAGCGCGA
GCCCTGTGCCGTTTGCCGATCAGGCAAAGACACTTTGCAGTTTCGAGCGAAGTGGCCCGACTTCCCACAACGGAAGCACTTTCCATCGTTGTGAGGACGT
TCATTTCCAGGAGTGGAAATGTACGAGATGTCCATTGGCTCTGGACCATCATGAACGACGTTCGATTGCCTTGGTGGTCTTGACGGAAAACCTTGGAACT
TGGCTTGTTTGATGCTAAACTCTTCTTGCATCGCGCGGCTGATGGCTTCTTCAAGGGTCTTTGGGTACTCACGGAACAATTGGTTCCGGATTGGACCGTC
GTTCAGACCCGTCATGAACGTCACAACTTGCGTTGGGACGTCAATCGGCTCGTCCACAATGCTCGAGACCAGATAACGAGCTCGCTGAGCATATGAGTGT
AGATCGAAACGACCTTGGCGAAGCTTGAGAAACTCGGCGCGTGCACGGAACTCACTCTGCGGTGGTTCAAACGCCATCTTGAGTTCTGCCTTGAAATTGT
CGTAGCTATAGAAGCAGTTTGGATCGGCCAAACGCTTCCCATAAGCCCAGCTCTTCGCACGACCCGCAAGGTTGGACATTGCGAACAACACTTGCTGCGA
GGGGTCGCGGAGTTGTCTTGCAGACATTGCTGCATCCAACTCAACGAACCATCTCGAAAGAGGCTCGTTCTCTCCGCCGCGATACGGAGACACGTTCAGC
TTCAGAGGCACCGTCTTGAAGGACGAAACAGGGGTTGCGACCTGCTTTCGAGATTCAACAATCTCGTGGTGCATGAAACTGACCGCAGCGCTCTTTTGGT
CTTCAGGGGATGCCGATCGAAGCAGGCTGACCACAGCAGCCTCCCCGATGACATCTCTCATCCGCTCCAGCGCTGACCACTCATGAGAAGACAAATGAGG
AAAATACTCATTCGTCAACTCGACAGTTTGCGGTACTGCTGAACCGAGTGGCACATCAACTCCTTCCATGTTCCCGGACATGGGTAAGAGTAGGTCTTGA
ACAGGAATGCGCGACGTGCTTAAAGCCGCGTCGTCAAACCTTTCACTTCACTGGGTCGTTGGAAGGACCGCTCGAAGTGCTACCAGGTGTAATGGGACGC
TGTTCACAACAGTTCCCAATACACGGCACACACGCTTGTGCAACGAGGAAGCG