Description :
From Genome Similarity Track
Location :
Scaffold_26:297600- 302163
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009462Similar to CAPSL: Calcyphosin-like protein (Homo sapiens)

Sequence
4563 bases(100 bases per row)
CATCATCTCACGTCAAAGCAGTCGCGCAGCAGAAGCTGTAGCATCTCGTCGCTGCCGACGACTGCGCGCAGGTTCACGCAGTACGCCTCAAAGTGCTCGA
ACGCTACGGCCCTATCCCCAGCTCCACTGGCGCCGCTGTCCGCGAGCTCAAAGCTGAGCGCAAACTCCTGGAAGACGTTGCTCGTGCTGGCGCCGCCGAG
CATCACGTCCGGATGCCGCGCAGCCTGGAAACTCTTGGCAAGTGCCACGGGGAACACGCGTCCGTTCCCAGCACGCTGGAGCGCCTGAAACACGCGCTGT
GCTGCGTCCAGACATGCGGGACTCAATGCGCCAAGCACGCAGTGGAAGAACTTGCGGATCCCCATGCGCGTGTTGCCTTTGCTGCTGCTATTACTCTGCT
GCAAGAAACGAGACCCGATACTGTTGTTGGGACCATTGCCAGTGCTGCTGCTCAGGTCGTACGCTGTCGCTTCAGGAAGCTGGTTGATGTATGCGAACAG
CGCTGTGCAGTGTGCCTCGTTGAGACGGAGACCCAGAGTAGCGCTCAGACACTCGCTGCAGTGCGTGGCCGAGATCGTACCAGTCTTAGCGTCAATGTAG
TGCAACATGCGCTTGCGGAGCTGCACGATGGCGGCGATGCGCTGCTGACGTACGTGATACTGGATCGCGTGGAATACCATGTCACCCCCTGGGTTTGTAC
TTGCACCAGACGCTGACGATACCGCACTCATTTCCATCGGCACCGCACTCGACGCCTCTCGCAATGTCAGGATCTTCTTACCAGCGGGCGTCACTGGCTT
TGAAGCAGTAGCAGGCTGCGTGAGGTTGATGCATGTAGCAGTTGCGATGCTTTTGGCATCTACGCGATCGTCCTGAGTGCGCAGTCTCGACTGGGCATCC
TGGATCGGCACGCCGAGATCGTTTTGCACTTCCTTGACGATGTCAGTGCCGTCAGCCAGTGTCACGAGCACTCGGCGGTTGGTCGAGTTGGCGCACCACC
CAATGCCGCCGCTGATGTGCCACGCGTTGCGCATCATGAGCTCGAAGTAGTCGTCGTCGTCAATGCTCGCGCTGATGTTCTCGTAGTAGTGGAGCCACTG
CGTCCATGTGATTTTGCCATTATGGATGCCGTCGACATCAAACGTCTCAAGGAACTCGCAGCAGACAGCGTCGGCGGTCTTGCGGCCTGAGAGCACATCC
GGGTGCTTGCTGGCGTCGTACGCCTCGACGATGTCGCTTGGCTCGAGAAGCCCGTTGCCATCCTTGTCCATGCGCTTGAACGCCTCTCGCACAAACAACA
CGCGACGCTCGTTCAGCGGATCGCGCACACCGACGAGGAACTCGTTCAAATCAATGCTGCCGCTGCGGTCGCGGTCAAAGTACTGGAAGAGCAGCCTCAA
GTCGGCGTCCGTGAGATCCTGGAGCTCCATGTCCTTCATAGCCTTGCGGAACTCGGTCACGTTCAGTGACCCATTGCCGTCGTCGTCCATGAGTCGAAAC
TTGCGGCTGAGACCGCAGAATCCGTGCGCGCCTTTTGCCTTGAGGCCGTTTTTCAGCTTTGCGATGATGAGCTGCACGCCGACGGGGTGGTCACGCTGCG
GCGTATCTTGCGCTGCGAGTGCGGCTTTTGTGGCTCCAGGCACTGCTGCTGCTGATGGTGGCTTGCTCGTAGGCACCATGGTCAGACACGCAGCGAACGA
GTCACTTGCGTTGGCGACCGATACGCGACGCGATGGCGCCGACTTTGCTGCTGGGTTGCTGTAGCCCAGAATATCGCAGAACGAAGTACTCGTACGCTGA
CCTGCGGGCCCTCGAGACGTAGCGTTCTGGGCTTCTTCAACTGTGGCGCGGCCGTCGGCATGGTTTACGAGCGTCCTGCGGTTGGCTGAGTTGGCGCACC
ACCCGTGGCCGCCGCTGATGTGCCACGCGTTGCGCATCATGAGCTCAAAGTAGTCGTCGTCGTCGATGCTCGCACTGATGTTGGCGTAGTACCGCGTCCA
CTCGTCGAAGGTGATCTTGCCGTCGTGGTCGACGTCGCCGAACGTGTCGAGAAACTCGGCGAACACGTCGTGCTCAGTTTTGCGACCCGAGAGTACGTCC
GGGTGCTTGCGTGCGTCGTAGACGTCGACAATATCGCTGACCTCGAGCACGCCGTTGCTGTCGGTGTCCAGGATATCGAACGCCATGCGCACAAACAACA
TCCGGCGCTCGCTCATGGGCTCGCGGATGCCTGCGAGAAACTCGTGGAAGTCCACGGCGCCGTCGTGGTTCGCGTCAAAGTACTGGAACAAGGTCGTTGC
GTCTGCAGGCGCAAGGTGCACTTTGGTCTCGTGGAGCGCCTTGTGGAACTCAGTGACGCTGATGCTGCCGTTTTGGTCGTCATCCATGAGCCGGAACTTG
CGCTGCAGCGAGATGAACCCGACGGCGCCCTGATCCTTGAGCGCGGTGCAAAGATGCGCGATGATGCGGCGCAGTTCCTTGCTCTGCTTGGCGGCTGCAA
ACATGCAACCTGGTTGTGATGAGGATGCGCCAACTCCACTTGCATGAGGCGTGGCGTTGGAATGGTGGTCACTGTTGAGGTCAGGCTGCAGGATGGCAAA
CGCCTGGCTGCTGCCGTGGCCCGTACCGCGCATCACGCGGACGTTTGCTGTCTGCTGGAAGGTGGACATGCTGTGTCCGCCTGGAGACTTTGGTGGTGGT
GCGCACATGTCGTCGACGAAGGAGGGCAAGTGCTGTGCGCTCAACTGCCACGTGTTACGGATCGTGAGGTCAAAGAGATCGTCGTCGTGGACAAAGAAGC
TCACGTTCTGATAGTACTGCGTCCATTGGCTCAACGAGATCTTGTGGCTGCTGCCATTATCGCTATCGTCATCGACGTCGAAGCTCTCGAGGAACTCGTG
GAAGACGGCGTCTTCGGTGGTACGGCCTGCGATCACATCTGGGTGACGGCTCGCGTCGTACGCCTGCACGATCTCGCTCGCATCGAGTTGCCCGGATCCG
TCGCGATCAATGGACTGGAACGCGGCCTGGACGAGCTGGAAGCGCCGGTAGTTCATTGGCTCGCGGATCATGTCGAGTGCCGCAAGCACCGACACCATGC
CGCGTCGGTCCTGGTCCAAGTGATTAAACAAGCAACGCAAGTCCACGTCGCTGAGCGGCACGGAGTTCAGACCTTTGAGCGCCTTCTTGAACTCAACGAG
CGTGAGCAGTCCGTCGCTGTCGGCATCGCTCAGGCGAAGATTGCGACTGAGCGCTACGAGACCGCGCAGCCCGCGCTCTTTGATCGTCGCGCGCATGCGC
TGGAGCACCGACGCCGTGCCAGCGTCCGCGGTTTGCAGTGGTGACGTTGACAATGTAGACGATCCGCTTCGCTTGGCAAGTGCGTAATGGCTCGGAGAAG
GCTGGCGGATCGATGGATCGACCATGCATGCTGCAAACTGCGTGCCTTTGAGAAACTCGGTTGTTGTGTGAGCCGCGCGCGGTGACGCAACATCAGGATT
CAGCGTCGCATTGCCCGTCGTAACGCTTGCATTACGATGCAACCGTGAAGGCACGGGTGGTGGCATCGAGGTTGTGGAGATCGACAGCGACGGCTTGGAG
TAGTTGGCTGCGATCGCAGGGTTGGTCTCCTGGAGCGCTTGCAGCAACGTCATCGGCGCGACTTCGGCTGAGTATCCACTGCCAGCAGCAGATGCTTGAA
GGTTGCTGCCCGTAGCCTCACTGAGTGATGTGCAACTCGTGGCTTTCCAGACGCGCTTCAGGAGCAGCTCGAAGTACTCGTCGTTTGGGACGTGGCCGCC
CACATACTGGAAGTAGCTCAACCATTGGTACAGGTTCACGAACGACGACCCCACTTGGCGTGTTGCGGCCTGGAAAGACGATTGGAACTCGTCGTGGACC
TGATCCACAGTTTTCTCGCCAAACATCACGCTTGGGTGCTTGCGCGCGTCGTGGGCAGCGAGGATGTCGGACACAGCGATGTATCCGACGCGCTTGCGGT
CCAAGTGTTCGAACACGCTTTGCACGAGCTCCAGGCGTTTACCGACTAGCGGACCGCACACGAGGTCTTTGAGTGCGTCGACAGGCACTTTGCCGTGCTC
GTTGTCGTCCTGAGAGAGCCACTGGACCATTGCGCGGGCATCCTGTGGCATGCAAGTTGTCCATGTCGGGTGGTCAGATACAAAAACGGGACACATGAAG
AATAAAGAGCTACGAAAGCGCTAACGCACCACGTCTGAGAGCATCACGTTGCTTTCATTAAACACGCGCTTGACGGACCCCTTCCCGAGTCCACCACTAT
GCGCAGTACTCTGCGCTTTGTCGAGATTCAAACCCCAGGTCACCCATACCCTGGTACAATTCACACACAGACACACAGGTTAGAAGCGTTTTTCCATCAG
GGAAGACGGAACCGAAGAACGAGGTATATTACATGATGCCGCCGGTGCGGAGCGCATTTCGAACCGACTCGAGGAGCTTTGGGAGGTCCACTTGGCCGGC
AGTGTGCTGCTGAAGGTTGTTCCATTCGGTGAGCGACGTGGGGGCCATCGGCTGCTTGGCCGT