Description :
From Genome Similarity Track
Location :
Scaffold_19:297567- 299176
Transcript NameFunction/comments
Physo_132115hypothetical protein

Sequence
1609 bases(100 bases per row)
CTCGACCGCCTTCATCGATGGTCTCAAGTCCCCCGCCGACCTCGAAGACGGCGCTCTCCGCCCCGGTGGCCCGCCATCCTCGCTGTTCTCACGCCAGAAC
TTAGGCCTGGCGGCCCACCAGATCTCCATCGCTGTCACCTACGGCTCCATCACCAGTGTCATCTACTCGGTGCTCAATAATTACCTAAACCTCAGCGCCG
TGCTGGTGGCGACCGCGACCGCGCTGGTGAAGGTCCCCAACGCGCTTCGACTGTTCACCGGCCTCATCTCGGACTGCTACCCGATCTGCGGCTACCGTCG
TCGGCCCTACATGGTTGCAGGCTGGGCTGTTTCGTTCGTCTGCTTCTTGGTCATGGCCGTCATCCCCCTGGGAGAGCCCTACTACGAAGACTGGTCCCTC
AAGAACATACCTGAGAGCGAGTGGACCTTGGAGCAGCAGGCGCTGATCTATTACGACGCGCCCAACCACGGCATCAAGCTCATCGTCCTCTTCGTGCTCG
CTCACTTGGGGACTGTGATCGCGTACGGAGCAGCGGACGGATACCTGGTCGAGCTGGCGCAGAGAGAACCGGAGGCTATTCGGGGTACCATCCAGACGGA
TATCGCCATTGTGACTGCAGCTGGGGGCATCTTCGCTGCATTCATGACCGGCCTGGGACTCAATAGCGAGGCGTACGGCGGGACCTTCTCATGGGACTTG
AGCTTTGCTGGCGTCATGGGGATCTGCGCGGGGTTCTCTCTCATCACCATTCCACTCAGTTGGTTCTGCGTCACGGAGGAGAAGGCTCCAGCTCAACCCA
CAGGCGCGTTCTTCGCGTACTTGTACGACTTCATCCAGTACCGCGTCATCTACCAAGTCATTGCCTTCCGCTTCTTCACTCAGATCTTCTCGAGCTTCTC
GGTCACCGCGGCCAGCAAAATCAAGAGTACCTGGTCCAAGGTCGAGCCGCTCAATGACGGCATTGCGAGTATGCTATCGTCCTTTATTAGCTTTGCGGCG
CTGTGGGCGGTGCGCAAGTGGGGACTCCACTGGAACTGGCGCTGGGTAGTCGTCTCGTGCCAGATCTTCGTCGTGGCCATCGATTGCTTCCCGACCTTCT
TCACCATTTGGGACGTATACCGCAGTCAGTGGTTCTGGCTCGGCGTCCCGCTCATTGCTGAAGTCCCCAGCAGCATCCACGACTTCATTGCGAAGCTCTT
TGTCGTTGAGATCGCTGAGGCTGGGAGTGAGGCCACCATCATGGGCTTGATCATCAGCATCAACAACATCGGCACCCCCTTCTCCACCGTCATGTACAAG
TCCATCGACGCCCACTTCAAGCTTACCACGGCGCAGATCACCAAGGACACGCACGAAGTGCGGACGCACGTGACCTACGCATACCTTATTGCGTACGCGT
TCAACCTCGCGTCCATCGCCTTCGTGTGCTGGTTGCCGAGACAGAAGGACCACGCTCACGAGCTCAAACGCACAGGCGGGAAGAGCAAGCTCATGGGCTT
CGTCACGGTCGGCTACATCACCTTCGGCTTCATTTGGGTCGTGCTCACCAACTGCTTGACGCTGTCGTCGAAGACTAGCTGCCTCCGTATCGCGGGTGGA
ACGGGGTGC