Description :
From Genome Similarity Track
Location :
contig_97:29745- 30906
Transcript NameFunction/comments
g10902.t1hypothetical protein

Sequence
1161 bases(100 bases per row)
CAGGTTCAGTGTTGATTCCCTGATGACTGGCAACTCCACGTCGAACAACTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCATACGC
ATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTTCATTA
CAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTC
AGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCGAGGTTGCGAGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTT
TTCACCGTCGAACCTTCGTCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCTAGGT
CCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCTCCCAGCACTCTCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATCCATC
TTCCGTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTGACATCTTCTTCGGTGGACTCACGGTGAAATCCCTGTGAATCACCAGAAGATCCGGGCACG
CGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGACGCGATCCGAACTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTT
GATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTGAAGATGTCAGTGGGTGACCAAG
GCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGTGGGTGACGGCCACGCGGGTATCCTTCACGCGGTCGTCGGTGTTGGTGATCGGGTCTTGGG
ACAAGTCGATCACGTGGGGGGTGTCCTTGGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGAGTA
GACGATCGCACCCTGGCCAAGCTATCCAGGTCTGCGTCGTGTCCTTGGTCGACTGGGTGGG