Description :
From Genome Similarity Track
Location :
Scaffold_23:297395- 301455
Sequence
4060 bases(100 bases per row)
TTTGCTCTCTCCACAATTCCGTTCTCTTGTGGTGAATAGGCGCTCGTGAATTGCTGTTCGATACCATTCTCTGCACAGTAATTGGCCAGCTCAGTACTCG
CAAACTCGCCGCCTTGGTCCGATCGTAATCGTTGAGCCGCAAGTTTAGGTAGCTACGTCTTCAGTTGAGTCAACAGCACCTTGATATGCCATGTCGCTTC
ACTCTTCTTTTCAAGTAAATAGGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATATGACCAGCCCCAGTGGCTTCGTCTGTAGTC
TGTTCAGTGTGGCAGCTATATGCAGTAGTGCCTCACCCCACAGGGTTTTGGTAGCCTCGTAGCACTCAGCATAGCCCGAACACGAGGCATCACGACTCCA
TTTGCTCTCTCCACAATTCCGTTCTCTTGTGGTGAATAGGCGCTCGTGAATTGCTGTTCGATACCATTCTCTGCACAGTAATTGGCCAGCTCAGTACTCG
CAAACTCGCCGCCTTGGTCCGATCGTAATCGTTGAGCCGCAAGTTTAGGTAGCTACGTCTTCAGTTGAGTCAACAGCACCTTGATATGCCATGTCGCTTC
ACTCTTCTTTTCAAGTAAATACGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATTATGACCAGCCCCAGTGGCTTCGTTTGTAGT
CTGTTCAGTGTGCAGCTATATGCAGTAGTGCCTCCCCCCACAGGGTCTTGGTAGCCTCGTAGCACTCAGCATAGCCCGAACACGAGGCATCACGACTCCA
TTTGCTCTCTCCACAATTCCGTTCTCTTGTGAGGAATAGGCGTTCGTGAATTGCTGTTCGATACCATTCTCTGCACAGTAATTGGCCAGCTCAGTACTCG
CAAACTCGCCGCCTTGGTCCGATCGTAATCGTTGAGCCGCAAGTTTAGGTAGCTACGTCTTCAGTTGAGTCAACAGCACCTTGATATGCCATGTCGCTTC
ACTCTTCTTTTCAAGTAAATACGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATATGACCAGCCCCAGTGGCTTCGTCTGTAGTC
TGTTCAGTGTGGCAGCTATATGCAGTAGTGCCTCACCCCACAGGGTTTTGGTAGCCTCGTAGCACTCAGCATAGCCCGAACACGAGGCATCACGACTCCA
TTTGCTCTCTCCACAATTCCGTTCTCTTGTGGTGAATAGGCGCTCGTGAATTGCTGTTCGATACCATTCTCTGCACAGTAATTGGCCAGCTCAGTACTCG
CAAACTCGCCGCCTTGGTCCGATCGTAATCGTTGAGCCGCAAGTTTAGGTAGCTACGTCTTCAGTTGAGTCAACAGCACCTTGATATGCAATGTCGCTTC
ACTCTTCTTTTCAAGTAAATACGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATATGACCAGCCCCAGTGGCTTCGTCTGTAGTC
TGTTCAGTGTGGCAGCTATATGCAGTAGTGCCTCACCCCACAGGGTTTTGGTAGCCTCGTAGCACTCAGCATAGCCCGAACCCGAGGCATCACGACTCCA
TTTGCTCTCTCCACAATTCCGTTCTCTTGTGGAATAGGCGTTCGTGAATTGCTGTTCGATACCATTCTCTGCACAGTAATTGGCCAGCTCAGTACTCGCA
AACTCGCCGCCTTGGTTCAATTCTTAATGCGTTGACTCGCAGTTTTAAGGAGCCTAACGTCCTCCGTTGAGTCAACAGCACCTTGATATGCCATGTCGCT
TCACTCTTCTTTTCAAGTAAATACGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATATGACCAGCCCCAGTGGCTTCGTCTGTAG
TCTGTTCAGTGTGGCAGCTATATGCAGTAGTGCCTCACCCCACAGGGTTTTGGTAGCCTCGTAGCACTCCGCATAGCTTGAACACGACTCATCACGACTC
CATTTGCTCTCTCCACAATTCCGTTCTCTTGTGGTGAATAGGCGTTCGTGAATTGCTGTTCGATACCATTCTCTGCACAGTAATTGGCCAGCTCAGTACT
CGCAAACTCGCCGCCTTGGTCCGATCGTAATCGTTGAGCCGCAAGTTTAGGTAGCTACGTCTTCAGTTGAGTCAACAGCACCTTGATATGCCATGTCGCT
TCACTCTTCTTTTCAAGTAAATACGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATATGACCAGCCCCAGTGGCTTCGTCTGTAG
TCTGTTCAGTGTGGCAGCTATATGCAGTAGTGCCTCACCCCACAGGGTTTTGGTAGCCTCGTAGCACTCAGCATAGCCCGAACACGAGGCATCACGACTC
CATTTGCTCTCTCCACAATTCCGTTCTCTTGTGGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGACAACCAGCACCTTGATATGCCCATGTCGC
TTCGCTTTTTCTTTTCAAGTAAAATACGCCGACTTGTATCTAGTGGCATCGCCGATGATGGCAAGAGAAAAGAATAGGACCAGCCCCGGCGGCTTTGGCT
TTTTTTTTATTGAGTGCGGAAGCGAGAAGCAGTAGAGCCTCCCGCCACAGGGTTGTGTTGTCGTCGTGGCAATCACCATAGCCCGGAACCACGAGGCATC
ACGACTCCATTTTGCTCTCTCCACAATTCCGTCCTCTTGTGGTGAATAGGCGTTCGTGAATTGCTGTTCGATACCCATTCTCTGCACAGTAATTGGCCAG
CTCAGTACTCGCAAACTCTCCGCCTTGGTCCGATCGTAATCGTTGAGCCGCAAGTTTAGGTAGCTACGTCTTCAGTTGAGTCAACAGCACCTTGATATGC
CATGTCGCTTCACTCTTCTTTTCAAGTAAATACGCCCACTTGTATCTAGTTGACTCGTCAATGATGAGAAGAAACATGATATGACCAGCCCCAGTGGCTT
CGTCTGTAGTCTGTTCAGTGTGGCAGCTATATGCAGTAGTGCCTCACCCCACAGGGTTTTGGTAGCCTCGTAGCACTCAGCATAGCCCGAACACGAGGCA
TCACGACTCCATTTGCTCTCTCCACAATTCCGTTCTCTTGTGGTGAATAGGCGCTCGTGA