Description :
From Genome Similarity Track
Location :
Scaffold_419:29739- 38661
Transcript NameFunction/comments
Aphin_H310_00844Hypothetical protein
Aphin_H310_00845Hypothetical protein
Aphin_H310_00846gamma-glutamyl hydrolase, putative
Aphin_H310_00847gamma-glutamyl hydrolase, putative
Aphin_H310_00848gamma-glutamyl hydrolase, putative
Aphin_H310_00849beta-glucosidase

Sequence
8922 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCAACTGTAGGAGTTTTTTTGTGCCTTCTAGAGACTTTTTCCACGTGTAGTAGTTAGTTCCAGCGAAGGGCACGTCACATCGT
TAGGATGTCGTGACCTCATTGGCCAGTTGGCCTACACTGGCGGATGGGCTTCGCCCACCGTTCACTTCACCTTACTTCTCGTTTTACGAAAACCCCAATA
TCCTCAACTCCGTGTTTTCTCTTCGCTAACAACCCCCCCAACTGGCTATGAGCACTACAACACCGAACACTGTTGCTTCCCGCCCGATCCTGTCTGTCAC
GCACCACCTTCGTGGCATCGACAACTTTGACGAGTGGCACTTCGAGTTGACCATGAAGGCGAAGGACTTACCGCCCAGGCGACGAAGTGCGCCGACGTCG
AGGCCATGTGGTCCATGAAAGGACTCCATCGGACACTTCGAGTCTTTGACGGCGACGTCAAGAAACTTCGCGCGCACCAACTGGAGGTTGCGTCTCGTCC
TTCGGACGCGTCTCCTTTACCTCTTGGCAAGCTTGGACGCCATGGTGCGAGCAATTGTTACATGCAATCCCCGTTTATCAATTTCTACAAAGAATGATAT
ACGACAGCTTCTTGAACTTCGCTGTATGCTTCTCAGTGCTCGTTACATGTAAACACGTGCAATGCTGTTGCGTCCTCTCGGGCAGCTTTCGATTCTTCCT
TTCATGGCTGTAGGAGACTTTGTACAAGAAGTTCGTGTTTGCCAGATTAGACTACGTTTGCCTACACCTTGCACTTGATCGAGGAACATTCTGTATTTCA
ATCAAAAACGAATCGTATTCAACGGCCTGTGTGGGTGCAGCTTGCTTGTGCTCTGCATCGCCTTGAACACAATGGGTCTGGTGCATCTGTTGGCATGGTC
GCACGGGCGAAGGGAATTGGTAATGGGACAGTTCATCTTTATACGAGACGTATTATCTGTTCCCCTGATTTTACTTTCTACTTCGGAAATTACGTGGCCC
AATTCTTCGGAAAGACGGCTGCTTGCTAAGTCAAATGCTGAGCGGTATGGATTTCGTAAATGCGTTTTGGCAACTGATGACACTCAAGTTGTTCTATACC
GAAAACCTGCATTACATGGAGAGGTAGGTATATAACAGTCGAAAAAAGGAATATTCGATGAATGTACTGTTGACGTTTGATAACTGCCGACAAATTCGGT
ATGTGCTTGCGGGATGGCCTGGCAGTGTTCACGACTCAACTGTTTGGGCTTCCGCATCACCCGCGCTACGGCCCCTGTCCTACTTCAACCCTAACCAATA
TCAAGCAGGCGACTCGGGCTTCCCCCTCGGTCGCCACATGCTCACCCCCTATCGCTTGCCCTCCGCGCGAGAAGTTGGAAACGACATCTTCAACACTGGC
CATGCGAGCCTTCGAGTAGTCTGCGAGCATGGGAACGGCCTGTTGAAAGGACGTTGGTCGAGACTTGCCCTCCTGCCTGTCGACATCCGAAACGAGAGCG
ACGTCCATTTTGTGTGCCACTGGATTTTGGCCTGCTGCGTTCTGCACAAAATCGTAAACCGCCTCCGTAATGGTGAAGACAGTGTGCCATTGTACTGTGA
AACTCCATGTCCCAGTCAAGTCAGCCACGCCATCCCAAAGATAATTTTTTGATCATGCGCGAAAACATAAAGTCCGAGCTGCTTCAATATTTAGGATTTA
CGAAAAATGACAAGTCGTTGTGATCTTTGTTTTTATCACAATTAGTCGACTGGTAATGCAATTGCAACAAGTTCACGGATTTTGTCAACATCTACCAACC
CCGATTGTACTAAATTTGCGATCATTGACACTTTCGCAGTTTGCAATTCCCTAACTGCTGATGCAGATTGGGTGAGCCTATCCCTTTCTTATTTGTACTC
GAATTTCTCGCATTCGAGGGAACACACCTGACTTTGCACGTCCATGTAGATTGACGAGAAGTACTTTCGTGGTGTGAGTCGCTTTTCCGTTGCGGGGAAG
TGACGAGAAGGCAGCGAGGAAGCAGCGCTGTGGGCGTTGCGTTGAATGCGTGCAACAATGTCCTTTTTGGCGGGCAGGGCATGGTCGCTGGTGGTCCCGG
GCCCTTTGCCAGGCGCATCGTTAGAGCCGACGGGTCCGTGCACGTTGATATCAGCCATCGGGCTCGTCGTTTGTGCTGCAAGGCGGCCAGGGTCATGGGC
GTCGTTGTCTGCCCAGTACTCGTCGTTGTCGGGGTCGTCAGGGTCGTGCTCTATTATTGGTTCGCTGTCCTCAGTAACCCCGGCATTGCCATTTGTCTTG
TTGTCGTACATGAAGGATTCGTCACAATCACCCGACTCATCGACTACATGAAATCGTGTTTTAGTGATGAGTATTAATGGCAAAGCATTCACAAGATTTA
CCGATGTCATTGTTCGTTTCTAACACAAATGATGGTCGAAAGTTCTGGCGTCCGACAAAAAGCGCATTCATGTCGTTGTAGTACGGACAAATACTCTCCA
ACTTGCTTTCAATCGTGAAGATTTCTACAGAATTCATGAGATTCATCTTCAATTTATGTTTTACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTATGTTTTACTTCGTTTGTAGTCCTTTT
GAGTGAGACCTCGCCCGCTGTTGTTCGGACCGCACCAACGAAGCGCTTTTTATGACGAGACGTACGCATCGTATCTACATGAATGTGTGTTGATGAATTC
AATTACCGGGACTTTGCGTCCTGCGTTTTCCACGTTCGCGTGCTATCACGAACGACCATGTTCACATAATCGGCCATTAGGGCGTGACCGTGGGCCTTTG
TGAGCCTCTGCCCGCCTTTCATCGACTTTCCTTTGGAGGCCTGGCCAGTCATCAACACAAAGTTGCCCGGAATGCGCAAGAATTCGAGCATGGCAAGGCG
CTCGGCGCCCGACATGCCTCGCTTCGCACGGTCGTCGCTCTCGAGCTCCATCGTTCCAACGCACAAGTGGGCAGCAGCTTGTGTGCCAGTAGTTTTGAGT
AACGTGATTAGATGTTCAGTGACCAAGTTCAGCTTGCTTTTGCTTTTGAAAGACCAAAAGTACCTCGCGAAGTACTTTTGCTTTTCGTGAATTCGAGAAT
CGACCTTGCGAACGAAAAGCGGACCAGATTTCCAAATTTACTCTCCCTAGTGTATCGCTCTAAAGCGATGGGGATCCTTCACCCCTCACACACGATGACC
TAACTTCCACCAATACAACCTTTTGCTAGCTTGCCCTGATCACCCCTGCATATGGCACAGGGACATTAGGGGCCTCCTCGGCTGTGCAAACATTGGATGT
TTTCTTTACAGGTCCGTTCGATTGGCCATCCCCTTCCAGGTTAAGGCCCCAACTGCATGCTTTCTCCATGTCATTGGCCAATCATTGGCGATTTAGGTGG
GTATAAATCATCCACAACGTTTTTTACACTCGCGATCACGGGTGCACTTGATGCATACAAATATGAAATTAATAATGGGGTGTACAACGCTGGGGAGTTT
TTCTCAACATCACTGAAATCGAAACAAACGCACGGATCCCCCGCGCTGTCCCTGGCCTTTGCCCCGTTCCATGGCACGCTGGTGTCGAGACCAACTCATG
TCCCTATACGCAAGGCGCTAATGAGGCCCCGGAAGCGCACCTCCACGCATGGATTCGGACGCACCTTGTCATCACGTTGAAGTGGAACAAATTGGCCAAG
AGGAAAGTATCTTTTTTCCACGAAAAGACTCATGTATCGTATCCACTTTCCGACCTCGACATGTATTTCGACTCTGGCCGCCGCGATGACGTACCGGCCG
GACGACCGCGTGCCTATCCTCTTCAAGCCGGCAGAACCCCAGCGCCGACGTACCACGCAATTGCTTGCTGTCGGCGTGCTCGTTGTATTTGCCTTGGCTG
TGTATGTCCCGTCGACTTTGTTTCGCCCCACGAGCGCCGTCACCAAGGTGGCTTCGCTTCGCGAGTCTTTGCCCATCCTGACCCGCAACCCCATCATCGG
CATCCATGCCCATCGTGACGCCGAACACGGCGACGACTTCATCGTGGCATCGTACTTGAAGTGGGTCGAAAGCGCCGGTGGCCGTGGCGTGCGCATCCCG
TACAACGCGTCCACCGCCGAATTGGACAAGTTGCTGAAGAGTGTGAATGGCGTGTTGTTTCCCGGTGGATCGGGCGACCCGAACGAAGCAGCCGAGTACA
TCTACAACAAAGCGATCGAACTGAACGACAAAGGCGACCACTTTCCTGTTTGGGGCACGTGCCTTGGCTTTGAATGGCTGGTGCAACTCACGGCTGGAAA
TATGTCGGTGTTGGATAGCGTCGACGCCGACAATATCAGCTCGACGCTCGAGTTTCAGCACAACTACAAGGGATCGAGTCGATTGTTTGGGTACAGCCAC
ATCTTTGACGTGCTCGAGAAGAAGGCGATCACGGCGAACTTCCACTTTAGCGGGATCTTGAAGGCCCACTTCGATGCGACCTCCAAGCTCACGTCGTTCT
ACAACGTGAGCAACTTCCTCGACTCTATACAATATGGACTAACCATCATGCAGGTGCTCGCCACGTCCGATGACAGACAAGGCCGAGCGTACGTGGCGGC
GATGGAGGCCAAGAACTACCCCATCTACGCCGTGCAATTCCACCCCGAAAAGAACCCATACGAGCTTGGCGATGACAAGACGGGCGGAACCATGAATCTT
GTCGACCACTCCGAGGAAGCAATTGTGACTTCTCAAACGTTTGCCCACTTTTTCATCGGGGAAGCCCGTCGCAACGGCCATACGTTTGCCGATCCTGCCG
TGGAGCGCGACGCTCTTCTGCTGAACCCGACCTTGTCCAGTCGATCGTACCCGTACTTTGAGTCGACGCTCGTTTTTCCAGTCGAGCCTTAACCACTTAA
ATGGGATTAGCGGCCGATCGCATGCGATCTCCTTCAACTTGCTCCCACGCCGAGATACACACACTTGCCACTCTCTCCCCGTCGGTGGAGGAAAATTCGA
AGGATTCGAAATTTGGGGAGGGCTGACCTGCCGGCCAGTCGGTCCTTGGCTCGATTTGTGGATCCATGGCAGCCAGCTCACTCGAACAACGCGCGCCCAT
GCTGCGCACAGCGCCTCAACATGGATCGAGACTCGTCACCATTTTAGTCGTTGCAACGATGGTGGTGTCGCTTGGTCTTGTACTCTCTCGACCATCGCAC
GAAATGGAAGCGGTGCAAGCGTTGAGAGCAGTCCCCAAACAAACGAGGAATCCGATCATTGGAGTTCACTCGCACCAAGATTCAGAATTTGGCGACGAGT
TTATCGCTGCATCGTACATCAAATGGATCGAGAGCGCAGGTGGCCGCGCGGTGCGCATACCGTGGAATGCGCCCGAAGACGAGCTCACACGACTTCTCTC
CAGCGTGAACGGCGTCCTTTTTCCAGGTGGCGACCCCGATCCAAGCCCTGCCGCGGCGTTCGTGTATGCTCGAGCGCTCGAGTTGAATCGCAATGGCACG
CACTTTCCACTGTGGGGCACGTGCTTGGGATTTGAATGGATGTTGCAGCTGCAAACAGCCAACCTCCACATCCTGGACAAAGTCGACGCGCAGAACTTGA
GCTCAACTTTGAGCTTGGTGCATCCGCGTCAGAGTCGCTTGTTCAGCTTCAGTCCAGTTTTCAACTCCTTGACGACGGAGCCCATCACGGACAACTTTCA
CCATTTTGGCATCCTAGCGGATCATTTTGCTGCGACCGAGTTGCTCACGTCGTTTTACAAGGTGCGGGTGTGTGGCTCGTTCATGCTTTCATCATCTACG
CGATCGACAGTTTGAGTCCGTGCCTGATGCTTTTTGCAGGTTCTCGCCACATCACAAGATCGACAAGGAGCGACTTATGTCGCTGCGATCGAAGCCGTGG
ACGTGCCATTCTACGGGGTTCAATTTCACCCAGAGAAAAACCCGTATGAGTTTGGCCTGTCGGCGGACGGCACGAGCTACGAATCGATCGACCACAGCTA
TGCTGCCATCATGACATCGCAAGCGTTTGCCCACTTCTTCGTCAGCGAAGCGCGGAAGAACGACCATGGATTCCCCACACCGGCTGAAGAGCAAGCTGCG
CTCTTGTACAACTCGCCTCGGTCCAATCGATCGTACCCGATGTACGAAGAAGTGTTTGTGTTTAGCACGAAGTAACAAGCGACCCGTCCTCTCGATCGGG
AACTTTATGCACGTCGGGGGCTCATGGAAACACGAGCACCTCAACGTAGACAGGGTACGACCTGTTGGAGGTCGGGACGTTGTACAGCAGGGACGACCGC
TTGACTTCAGCGTCGGCAAAAGAATGATTGTTGCGCCTCGCTTCTTGCATAAAGAAGTGGCCGAATGCTTGCGAGGTCAAGATCGCTTCATACGTGTGGT
CGATCCACTTCCACAAGTTCCCGTCAGGGTACTCGCCAAACTCGAACGCGTTCTTCTCCGGGTGGAATTGCGTGCCGTAGAAAGGATATTTGTACGCTTC
GATCACTGAAATGTACGTGCGTCCTTGGCGGTCCACCGATGTCGCGACGGGGTTGTAGAATGACGAGAGCAAGTCCGTGGCGGCAAAGTGATGGTCAAAG
ATGCCAAAGTCGTGGAAGTTGTCTGTGAGCGGCGCGGTTTTCAGCACGTCAAACACCGGGCTGAAGCTGAAAATGCGACTCGGAATGGCATTGCGGTCGG
GTGGCGGGAATGCCAATGTCGAGCTGATGTTGGCGGCGTCGACAGTGTCCAAGATCGAGTTGTTCTTGGACTGAAGCTGCACGAGCCACTCGAAGCCCAA
GCACGTTCCCCACACGGGGAAGTACGTCCCGTTGTCGTTCAACTCAATCGCGTACTGGTAAATGAACTCAGCGGCTTCGTTCGGGTCGCCGTCCCCGCCA
GGAAAGAGCACTCCATTGACGCTGCGCAGCAGCTTACGGAGCTCGGTCTGCGACGCATTGTACGGAATGCGAACGGCGCGACCACCAGCACTTTCGACCC
ACTTGACGTACGACGCTGCAATGATTTCGTCGTGGTAGGTAGACGACTGATGTGAATGGATGCCAATGATGGGGTTCTTGGTGAGCACGGGAAGGTTGCC
ATGGAGCACGACTCGTCCCGACGATGGAGAAGCACATGTGATGTACACAGTGACGACCACGACGGCAAGCAACGACACCACAGCCGCGATACGGTACATC
GCATTCTTGCGGCGTTGAGGCGTGCGCGCGGCGCCGGGCTTTGTGAGGATGGGCAGTGTGTCTTCCGTGGATCCCATCGCCCCAAGTGCTGTGGAAGAGT
AGAAAGGTTTCATCGTCTGTTCGTTGTCCTTCGTAGATCAAACATCGTTCCGACCAACCGCAGACGATTATTCAGCAAACTTCAACTTGGGAAATCCAGT
GGGCGACCCAGTCACAGCCCCGCATTTGAGTGACTCGACCAAACGCCAACGCCACCCGCACGAGCCTCTAGCGTGCTGAACACACCACCCAGCCTCCCCA
CATGTGATCGATTCCATCTTACCAACTTCCTTGACGAGGGGACATGACATGGCCTGATTGTGTGTCAACAGTTTTTCAATATTTTTTAGTAACACATTGG
CGTTTTCGCATTTCGTGGTGCCTGCGAATATATTTGACTTGGTTTCAGTATACGGAGTGGAATGAAACCTGATTGGTTGAATGGAAACCTTCCATCGCGT
TTTGGACAAATCGGGTGGTCGCAGCTATCTAAGATCGCGCGACCGTTTGTGGGAGCCGTCGTTTCCGTGGTCGCCCCTACCTGAGATTGAAGCCGTCCGT
GCCAAGCGTCACGTCGCCAACTGTGCCCCGAATGACGGCGTACTTTGCACACGGGAAGTGCTCCATGTGGCTCGTCATCGTCGCTGCCATCGGCATCCCA
TGGCTTGCAATCGCCGCGCCACAAACTGGTGGGTTCGCCAGATGCCTCCGCGGGCTCACCTCGTTGACATGATGTAGTTCCCACGTCTCCAACGAATGTA
CAGCTGTCGGTTGTGGATCAAAACGATCTTTTCGTGTCGTTTGCCCCTCCTCTAAGCGATGGCGGCTCCACTATATCGGCCTACGAAGTACCACGACCCG
CACGAGCATGGCATTCATGGTCTTGTCTAGGTGGACTGGGACCCGAATCCTGGGGTTCAAGAAGTGCAAACAGTCACAACATCGACGTACACGGGCCCCA
ACGAAGTTCAAACTGTCATGACGTCGGCAGCCGACATAAATGAAGTCCAAATCGTGACTACGTCTGCGACCATGGTTCGCGAAGTTCAAGTCGTCACGAC
ATCTGCCGCTCCGGGGCAAACGCTGGGTGGAGGTTTCACCCTTCAGCTTGACACAACAGCTACTGGGGGAAGCGTTCGATTGTCCGGAGTCATTGGATTC
ACGGCGGGGGCTTCTGGTGATCGGTCTTGCATGCGCGAAATCCTGAATGCTATGGCCAACATTGGACCCACCGGCGTATTTGCGGTCTCTAGAACGGGAC
CTGATGCCCAAGGAGGTTACTC