Description :
From Genome Similarity Track
Location :
contig_7:29738- 34958
Transcript NameFunction/comments
g2458.t1hypothetical protein
g2459.t1hypothetical protein

Sequence
5220 bases(100 bases per row)
ACGAGTTCTTACATATGAAACGAGATTGGAACCAGAGTGCGGACAAGTTAGCTAGCGAAGCTCTTCAACGAGGCGAAGGAACCGTAGTTACCTCGGAAGC
TGATCGACAGGACCTGATCACACTCAATCGGCTGGACGAGCTCCTGAAGCCGAAGGATAATAACGCTGTAGCTCGTGTATCAGCGGTAACGCGATCTGCA
CGACGGTCGAGACGAGTGCCGAGAGTTCTGCAAGAAGCGATCGTGCAACGCATCAGAAGTGAACGGATCACGCAAGCCCAAGACGAAGAGCAGTGGATCG
CGAACATGAAATCGTACCTGCGGGGCGAGGTGACCGACCTGTCGTCGAACGATGCTAAGTCCTGCGCCAAGACCGCTTGCGATTACGAGCTGGACGAGAG
CGGACTCCTGCTGTACTGCCCGACAAAACCGCAATCGGACGAAGACCGAGACTCCCTCGCGCGGCTGGTCATCCCGGAGACGCTACAACAAGACGTCCTG
CATCATTACCACGCTAGCCTGGAAGGCGGGCACCAAGGGATCGGGAGGACTTACCAGCGCGTCAAGGCGCACTTCCACTGGAGAGGGCTGTTCAGGAGTG
TTCAGCGGTTCGTGGGAGAATGTGTGGATTGTGAAACTGGGAAAGGGCGCCCCCTCATTCAGGGAGAATCGCCAGGGAATGTACAAGCTACGTACCCATT
CCAAATGATCGCCATGGACCACATTCCGTCTCTACCGAAGTCGTACAAAGGAAACACAGAGCTGTTAATCTGGGTTGACCTTTTCACCGGATACGTGATC
GCGAAGGCTAGCGCCTCTCGCACTGCCCAAACGATTGCCGAGAATTACGAAGAATGCGTCTTTCGACGTTTCGGCGCCAGTGAGGTCATCCGCCATGATC
GAGAGCCCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGCCGGATAGTGGGTCAGAAACAGAGAGCTACGATGGCGTACCGGCCGCAAGCCAACGGAAC
TGCCGAACGAATGGTGCAGACTCTGACGCGATCGCTGAAGATGTACGTGTCAGACGTGAACCAGAGAGACTGGGACGAGTACGCGGAGCGACTCACGTTC
GCTCTAAACACGGCCCAGGATCGAGTTCGTGGCGACACGCCATTCTACTGGCCCATGGGTGGGACCCGCGATCGACACTGGAGGCAGCGCTACCGTTAGG
CAGCACGCGCCGACGTGATCAGGAGCCCCGTCGATGGAGGTACCACGTACAAGAACACTACCAGCGAGCGCGGGAACAAGTTCGCGAGCGACTGCGCGAG
GCGATCAGAGGCAGAGCCAACCGACACAACGAAGATCTGCGGCCCCACAACATCGCGGTGGGCGCTCAGGTATGGCTACACCTCGATCGAGTCAAGGAGG
GGTATGCACGGAAGCTCGCACACCTGTGGCATGGACCTTTTCGTGTCGCCGAGATGATCGACGATCACGCCGCACGTCTTGAGATCGCGGGTTCGGAGTA
TAGGATCTTCCCGATCGTGCATGTGTCCAAATTGAAGTTGGTCCGGAGGTTTCCCGATCGTCCTGACGCGCCGTTGCTTGTGGCCGAGAGCGATCGCCTG
GATTTCGATGAGGCCCTCCTGCCGGAGGACAGCTGGGAGACCCCACTCGACGAAGGCGAGTTTGAAGTGGAGAAGATCGCGGATGTAAGAACCGGCCGCC
GGACGCGCTACGGACGAGTCCATCGAGATTTTCTGGTGTTCTGGAAGGGTTACGACGATCCAACTTGGGTCGATGAGGCGGACCTTAATTGCGGCGCTAT
GTTGCGCGACTTTGAACGAGGACTGGCCAGCCGGAACAGATTTGAGGTGATGCAGTCCCATGAAGGGGAAGCGGAAGACCCCCTGCAGTAACAGGCACTG
TAGGGGAGGAGGAGAATGAAGGATGTGCGGGATGGCCGCACATCGGAGGAAGGGGTAATTTGTGATTTGTGAGTTTGCGATCGGGGAAGGAAGAGGCCGA
TCGGGGTCGGGTGACCCAATAAAGAGGGAAAGAGAGGAGAAAGAATGTATTGCAGAAGCTTATCAAGACCTTGGAGAGGGTTACTTCACTCAGAATCGAC
GATGGACCGAAACTTACCGTCTAGGCGTGCGATGCGGGACCCGGGATGATCGCTCAGTTGTGTGCGATATTGGTTGCGCCACGGGTCGGCAGAATCGGCG
GTAGGAAGAGCGTTGATTAAGTCAGGAGGCGCCCGCGTGGCTCCGAAACCGGGATACCAAAAGCATCGTTCGTTTTGGCGCGGAAAATGAAGGAAGAAGG
GATCCAGAAGCAGGTCGAGATCGCAGTGTCCAGCGATCATCCCAGCCAGTAGATGCTTGAGGATGGTCTGCCACCGGGGACCAGCGCGAGATCGACGCTG
TTTGCACCCGAGCCAAAACTTAGCCAGAAAAGGGTTGGCCAACTTCATGGCCTTGGTGATCGGTAGCTTGTGGGTAGACTCCCAGAATGCTTGACGAAAC
TTCTTCGAATGCCGCGTACAACTGTACGAACTCCGCGAACCATCCTGTCGCATCAAACGATCGCGGCGGAACTGCCCGACCCAACACAATCCATGGTCGC
AGTTTATACAACGCCAAGATATTAGCCTGGGTGATCAAGTCGGGATTCCAGGTGCCAGCAGAAGGAGTGCGGGTCCGACGCGGGAATAGCCAAGATGGCG
GACGACTCCACTGACGAAATAACGTGGCGACCGTCAAATGGCGGACGCTGAGTTGACGAACCGGAGAAAGAGGCCAAGGGTCCACGTCCGTACCCCGCAA
ACCTTACAGGACTCCGGTACCCTGGGATCCAACGGTCCCGAGAGATGGTGGTGGGATCGAGCTGATCGAGCTCGGCATCGGACAAGACAGAGTTCGCTGA
ATCGCTGCTATCGGAATCGCCCGAGTGGTGGTCGCCGGCGGAGCTGCCTCCGGACGAGTCACCGCCATCACCGCCGCCGTCACCGCCGCCGTCATCGTCG
TTGTCGCCCTCGTGGTCGCTGTCTTTATTATCGCCGTCGTTACCGCCATCATTGTGGTCGCCGTCGCCGTCGTTATCGTCATCATCACCGTCGTCATCGC
CGTCGTTACCGTCGTCATTGTGGTCGCCGTCACCGGCGTTACCGCCATCGTCGTTATCGCGGTCATCGTCACCGGTGTTACCGCCATCGTCGTTATTGCC
GTCGTCGCTGGCTTGGCCATCCGATCCACGATCGCTAGAAGAGTCGACGTTGATCGGCTTGCTGGGAGTACCTGCTGCGCGACGCTTCGATCGGGACAAA
TGTGATCGTCTACTAGAAGAACGCGATCGAGCGAGACCGGCGTTCAGAGCGTCATCATCGTCGCTGTCGCCGGATGAAGGAGATCGGCGACGTCGAGACT
TGTGAGGCCGCTTGCGACGAGACGACGGACTTGATGGAGAGCGACGGGAAGGAGAGCGGCTGGCGAGACGTTTCCGTGATGGAACCTTTTTCAGCAGGGA
GGGATCGCTGGCTGGCGTGGGAACAGGAGTCGCCGGAGGAACGATCGAGCCAGGTTGAAGTATGCTGGTGATGTCCGAAAGGCGCCGCAAAGCACCGTCT
CGCTCTGTGATCAGCTGATCACGCACGCTCTCCAGATCTTGTTGGGATTGACGGGCGGTCGCGAGGTCAGCACGCAACACGGCATTAGTGCTGCTCAGCT
GGTGGTTGGCGGCTACCGAAGACTGGAGGCTGCTTGCTCGCTGCTCCAGTCGAGCTATGGAAAGGCGGGCGGATGTGACTTGGTTACCTGCAAGAAAGAG
AAACGGGATTAGATCAACGGACGCTGAAGTATCGACGCGATTACGTACGTGCTTGTGAAAGCTCGTTCCGAGCGCGATCACGTTCTTGGGTCACCCGTTG
TAGTTTCGCCGCTTGATCGCTTAGATCTTGGTCGGACTTGTCCAGTAGGTCCTGCAGCCGTTGTCGTTCCTGAAGACTCTGGTCGAGGGCACGCCGGGAA
CCGTGTCGGGCTTGCGCCAACTGGTCGCGCAATTCGGACGCACGACGCTCGAGTAGCGCCACCTGTTGCCGGAGGATCTGCGCCGATCCCTCGAGAGCCT
TCTGGGAGGTCTCGAGATCGCGAATTGAGTCGCGGGCCTGATCCAGATCACGGTTCGCTAGACCTTGGGCTGCGATCGCCACGTTCAGCTGGGATTGGAG
TTGGAGGGTGGTCGGGTTGACCCCAGGCGGAGGCAGAGCTGTGTCACCAGAAGTCGTGCTGGCAACTGCCAATGCAGCCGTTAGACGCCGCTCCAAATCA
TCGATTTCCCTTTGGAAGTCAGCGACGGCTTCCGCGTGTACGTGATCTTGGAGGCGCATACGATCACGGAGGTTGGTGAGCTCGGTTGCATTGTCGAGTC
TCCGGGCCAGAGCTTCTCGGGTTTCCGCTAAGTCCAGGATAGACTGCGCGAGACGATGGGACAGCTGACCGTACTTCTGCTGGACGAGGCAGACGAATGG
GGACGGTGATTGAGCCGACCGAATTGTGTGCTCCAGGTCTGCCACACGTTGTCGCAAGGCGAAGTAGGACTGCAACAAGTCGTTGTAGCTGCGCTGGAGT
GCCTGAAACTCACTCTCGCGATCCAGAGCGGCTTCAACTGCAGCCAACGATCTCCGGATAGTGATCTGGTCTAAGGGCGGCAACGAGGAACCAGCTTGAG
GCAACGACTCGGTCGAGAGATCGCCAGGTTGACCTTCGATTCGGCGTACATGTTCGGAGAAAGCTGCAGGAGTTGTGACGGTGGCATCGGAAGCCACAGG
AACAGCGGTGGACGAATTCGAGGTCGTAGCCCTCTGCGGCGACGAAGGAGATCGGGAAGAGGCGGGCGTAGGCGAGTGGGAAGAAGGATCGTTCGGGGAA
CGCCTCTGATCCGGCGAAGAGTTGTCCGACATGGTGCTGTGGAGGTGTGGTGGCGAGGAGCGATAAGAAGAAGTGACGAGTGTGCACGCCAAGACTGTTG
GGCAGCCCCGGCATGTACAGGGGGCGATTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTAC
GATCGGAGGTTGATGAAGGCAGACTTTGGAGGGATTAAATTGGACCTGAGGGGTAGGGGTATGGAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGG
TGTATACCGGTATGCGGTAT