Description :
From Genome Similarity Track
Location :
contig_7:29736- 34939
Transcript NameFunction/comments
g2313.t1hypothetical protein
g2314.t1GBG66957.1 hypothetical protein CBR_g74645 [Chara braunii

Sequence
5203 bases(100 bases per row)
CGTGGCCAAGACACGAGTTCTTACATATGAAACGAGATTGGAACCAGAGTGCGGACAAGTTAGCTAGCGAAGCTCTTCAACGAGGCGAAGGAACCGTAGT
TACCTCGGAAGCTGATCGACAGGACCTGATCACACTCAATCGGCTGGACGAGCTCCTGAAGCCGAAGGATAATAACGCTGTAGCTCGTGTATCAGCGGTA
ACGCGATCTGCACGACGGTCGAGACGAGTGCCGAGAGTTCTGCAAGAAGCGATCGTGCAACGCATCAGAAGTGAACGGATCACGCAAGCCCAAGACGAAG
AGCAGTGGATCGCGAACATGAAATCGTACCTGCGGGGCGAGGTGACCGACCTGTCGTCGAACGATGCTAAGTCCTGCGCCAAGACCGCTTGCGATTACGA
GCTGGACGAGAGCGGACTCCTGCTGTACTGCCCGACAAAACCGCAATCGGACGAAGACCGAGACTCCCTCGCGCGGCTGGTCATCCCGGAGACGCTACAA
CAAGACGTCCTGCATCATTACCACGCTAGCCTGGAAGGCGGGCACCAAGGGATCGGGAGGACTTACCAGCGCGTCAAGGCGCACTTCCACTGGAGAGGGC
TGTTCAGGAGTGTTCAGCGGTTCGTGGGAGAATGTGTGGATTGTGAAACTGGGAAAGGGCGCCCCCTCATTCAGGGAGAATCGCCAGGGAATGTACAAGC
TACGTACCCATTCCAAATGATCGCCATGGACCACATTCCGTCTCTACCGAAGTCGTACAAAGGAAACACAGAGCTGTTAATCTGGGTTGACCTTTTCACC
GGATACGTGATCGCGAAGGCTAGCGCCTCTCGCACTGCCCAAACGATTGCCGAGAATTACGAAGAATGCGTCTTTCGACGTTTCGGCGCCAGTGAGGTCA
TCCGCCATGATCGAGAGCCCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGCCGGATAGTGGGTCAGAAACAGAGAGCTACGATGGCGTACCGGCCGCA
AGCCAACGGAACTGCCGAACGAATGGTGCAGACTCTGACGCGATCGCTGAAGATGTACGTGTCAGACGTGAACCAGAGAGACTGGGACGAGTACGCGGAG
CGACTCACGTTCGCTCTAAACACGGCCCAGGATCGAGTTCGTGGCGACACGCCATTCTACTGGCCCATGGGTGGGACCCGCGATCGACACTGGAGGCAGC
GCTACCGTTAGGCAGCACGCGCCGACGTGATCAGGAGCCCCGTCGATGGAGGTACCACGTACAAGAACACTACCAGCGAGCGCGGGAACAAGTTCGCGAG
CGACTGCGCGAGGCGATCAGAGGCAGAGCCAACCGACACAACGAAGATCTGCGGCCCCACAACATCGCGGTGGGCGCTCAGGTATGGCTACACCTCGATC
GAGTCAAGGAGGGGTATGCACGGAAGCTCGCACACCTGTGGCATGGACCTTTTCGTGTCGCCGAGATGATCGACGATCACGCCGCACGTCTTGAGATCGC
GGGTTCGGAGTATAGGATCTTCCCGATCGTGCATGTGTCCAAATTGAAGTTGGTCCGGAGGTTTCCCGATCGTCCTGACGCGCCGTTGCTTGTGGCCGAG
AGCGATCGCCTGGATTTCGATGAGGCCCTCCTGCCGGAGGACAGCTGGGAGACCCCACTCGACGAAGGCGAGTTTGAAGTGGAGAAGATCGCGGATGTAA
GAACCGGCCGCCGGACGCGCTACGGACGAGTCCATCGAGATTTTCTGGTGTTCTGGAAGGGTTACGACGATCCAACTTGGGTCGATGAGGCGGACCTTAA
TTGCGGCGCTATGTTGCGCGACTTTGAACGAGGACTGGCCAGCCGGAACAGATTTGAGGTGATGCAGTCCCATGAAGGGGAAGCGGAAGACCCCCTGCAG
TAACAGGCACTGTAGGGGAGGAGGAGAATGAAGGATGTGCGGGATGGCCGCACATCGGAGGAAGGGGTAATTTGTGATTTGTGAGTTTGCGATCGGGGAA
GGAAGAGGCCGATCGGGGTCGGGTGACCCAATAAAGAGGGAAAGAGAGGAGAAAGAATGTATTGCAGAAGCTTATCAAGACCTTGGAGAGGGTTACTTCA
CTCAGAATCGACGATGGACCGAAACTTACCGTCTAGGCGTGCGATGCGGGACCCGGGATGATCGCTCAGTTGTGTGCGATATTGGTTGCGCCACGGGTCG
GCAGAATCGGCGGTAGGAAGAGCGTTGATTAAGTCAGGAGGCGCCCGCGTGGCTCCGAAACCGGGGTACCAAAAGCACCGTTCGTTTTGGCGCGGAAAAT
GAAGGAAGAAGGGATCCAGAAGCAGGTCGAGATCGCAGTGTCCAGCGATCATCCCAGCCAGTAGATGCTTGAGGATGGTCTGCCACCGGGGACCAGCGCG
AGATCGACGCTGTTTGCACCCGAGCCAAAACTTAGCCAGAAAAGGGTTGGCCAACTTCATGGCCTTGGTGATCGGTAGCTTGTGGGTAGACTCCCAGAAT
GCTTGACGAAACTTCTTCGAATGCCGCGTACAACTGTACGAACTCCGCGAACCATCCTGTCGCATCAAACGATCGCGGCGGAACTGCCCGACCCAACACA
ATCCATGGTCGCAGTTTATACAACGCCAAGATATTAGCCTGGGTGATCAAGTCGGGATTCCAGGTGCCAGCAGAAGGAGTGCGGGTCCGACGCGGGAATA
GCCAAGATGGCGGACGACTCCACTGACGAAATAACGTGGCGACCGTCAAATGGCGGACGCTGAGTTGACGAACCGGAGAAAGAGGCCAAGGGTCCACGTC
CGTACCCGCGAACCTTACAGGACTCCGGTACCCTGGGATCCAACGGTCCCGAGAGATGGTGGTGGGATCGAGCTGATCGAGCTCGGCATCGGACAAGACA
GAGTTCGCTGAATCGCTGCTATCGGAATCGCCCGAGTGGTGGTCGCCGGCGGAGCTGCCTCCGGACGAGTCACCGCCATCACCGCCGCCGTCACCGCCGC
CGTCATCGTCGTTGTCGCCCTCGTGGTCGCTGTCTTTGTTATCGCCGTCGTTACCGCCATCATTGTGGTCGCCGTCGCCGTCGTTATCGTCATCATCATC
GTCGTCATCGCCGTCGTTACCGTCGTCATTGTGGTCGCCGTCACCGGCGTTACCGCCATCGTCGTTATCGCGGTCATCGTCACCGGTGTTACCGCCATCG
TCGTTATTGCCGTCGTCGCTGGCTTGGCCATCCGATCCACGATCGCTAGAAGAGTCGACGTTGATCGGCTTGCTGGGAGTACCTGCTGCGCGACGCTTCG
ATCGGGACAAATGTGATCGTCTACTAGAAGAACGCGATCGAGCGAGACCGGCGTTCAGAGCGTCATCATCGTCGCTGTCGCCGGATGAAGGAGATCGGCG
ACGTCGAGACTTGTGAGGCCGCTTGCGACGAGACGACGGACTTGATGGAGAGCGACGGGAAGGAGAGCGGCTGGCGAGACGTTTCCGTGATGGAACCTTT
TTCAGCAGGGAGGGATCGCTGGCTGGCGTGGGAACAGGAGTCGCCGGAGGAACGATCGAGCCAGGTTGAAGTATGCTGGTGATGTCCGAAAGGCGCCGCA
AAGCACCGTCTCGCTCTGTGATCAGCTGATCACGCACGCTCTCCAGATCTTGTTGGGATTGACGGGCGGTCGCGAGGTCAGCACGCAACACGGCATTAGT
GCTGCTCAGCTGGTGGTTGGCGGCTACCGAAGACTGGAGGCTGCTTGCTCGCTGCTCCAGCCGAGCTATGGAAAGGCGGGCGGATGTGACTTGGTTACCT
GCAAGAAAGAGAAACGGGATTAGATCAACGGACGCTGAAGTATCGACGCGATTACGTACGTGCTTGTGAAAGCTCGTTCCGAGCGCGATCACGTTCTTGG
GTCACCCGTTGTAGTTTCGCCGCTTGATCGCTTAGATCTTGGTCGGACTTGTCCAGTAGGTCCTGCAGCCGTTGTCGTTCCTGAAGACTCTGGTCGAGGG
CACGCCGGGAACCGTGTCGGGTTTGCGCCAACTGGTCGCGCAATTCGGACGCACGACGCTCGAGTAGCGCCACCTGTTGCCGGAGGATCTGCGCCGATCC
CTCGAGAGCCTTCTGGGAGGTCTCGAGATCGCGAATTGAGTCGCGGGCCTGATCCAGATCGCGGTTCGCTAGACCTTGGGCTGCGATCGCCACGTTCAGC
TGGGATTGGAGTTGAAGGGTGGTCGGGTTGACCCCAGGCGGAGGCAGAGCTGTGTCACCAGAAGTCGTGCTGGCAACTGCCAATGCGGCCGTTAGACGCC
GCTCCAAATCGTCGATTTCCCTGCTTCCGCGTGTACGTGATCTTGGAGGCGCATACGATCACGGAGGTTGGTGAGCTCGGTTGCATTGTCGAGTCTCCGG
GCCAGAGCTTCTCGGGTTTCCGCTAAGTCCAGGATAGACTGCGCGAGACGATGGGACAGCTGACCGTACTTCTGCTGGACGAGGCAGACGAATGGGGACG
GTGATTGAGCCGACCGAATTGTGTGCTCCAGGTCTGCCACACGTTGTCGCAAGGCGAAGTAGGACTGCAACAAGTCGTTGTAGCTGCGCTGGAGTGCCTG
AAACTCACTCTCGCGATCCAGAGCGGCTTCAACTGCAGCCAACGATCTCCGGATGGTGATCTGGTCTAAGGGCGGCAACGAGGAACCAGCTTGAGGCAAC
GACTCGGTCGAGAGATCGCCAGGTTGACCTTCGATTCGGCGTACATGTTCGGAGAAAGCTGCAGGAGTTGTGACGGTGGCATCGGAAGCCACAGGAACAG
CGGTGGACGAATTCGAGGTCGTAGCCCTCTGCGGCGACGAAGGAGATCGGGAAGAGGCGGGCGTAGGCGAGTGGGAAGAAGGATCGTTCGGGGAACGCCC
CTGATCCGGCGAAGAGTTGTCCGACATGGTGCTGTGGAGGTGTGGTGGCGAGGAGCGATAAGAAGAAGTGACGAGTGTGCACGCCAAGACTGTTGGGCAG
CCCCGGCATGTACAGGGGGCGATTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCG
GAGGTTGATGAAGGCAGACTTTGGAGGGATTAAATTGGACCTGAGGGGTAGGGGTATGGAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTAT
ACC