Description :
From Genome Similarity Track
Location :
contig_97:29736- 30738
Transcript NameFunction/comments
g10902.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TTTCGCAAACAGGTTCAGTGTTGATTCCCTGATGACTGGCAACTCCACGTCGAACAACTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTC
AGCATACGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGA
TCTTCATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTC
TTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCGAGGTTGCGAGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGT
CCTTCGGTTTTCACCGTCGAACCTTCGTCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTT
CTTCTAGGTCCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCTCCCAGCACTCTCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGG
CGATCCATCTTCCGTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTGACATCTTCTTCGGTGGACTCACGGTGAAATCCCTGTGAATCACCAGAAGAT
CCGGGCACGCGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGACGCGATCCGAACTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGG
TACTCCGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTGAAGATGTCAGTGG
GTGACCAAGGCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGTGGGTGACGGCCACGCGGGTATCCTTCACGCGGTCGTCGGTGTTGGTGATCG
GG