Description :
From Genome Similarity Track
Location :
contig_97:29735- 35007
Transcript NameFunction/comments
g12831.t1hypothetical protein
g12832.t1hypothetical protein

Sequence
5272 bases(100 bases per row)
TGCGACGATCCGGTTTGGCTGCGAGTCGGTGTTGGTCTTGTACGTTGAACCGGGACGACGCTACCGACAAGGGGCGTCAGTTTCGCAAACAGGTTCAGCG
TTGATTCCCTGATGATTGGTAGTTCCAAGTCGAATATCTCGTTCGCGTCGAAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCATACGCATCAGAAGTTT
CACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGGCCTTGAAGTTCCCCAATTGGCTTCGGACGCACGATCTTCATTACAGGATCTTCG
TGCAGGAACTTGTACAGGTCCTTGTAAAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTCAGACTCCGGTG
CCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCGAGGTTGCGTGCGAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGA
ACCTTCGTCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCTAGGTCCATCGCTGAA
CCTTCCTCCATCACATCGTCAGAGCTCCTCCCAGCACTCTCACGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATCCATCTTCCTTCGACG
ACTCGTTCCCTGGTTCCGTCTTGATCTTGACATCTTCTTCTGTGGACTCACGGTGAAATCCCTGTGAATCACCAGAAGATCCAGGCACGCGCACCATTGT
GGCGGAGCGGGATCGCGAAAATCGATGACGCGATCCGAACTTGCCAGCGGTAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCGTG
ATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCGGAAGATGTCAGTGGGTGACCAAGGCGGAGGTT
GGAGCTGGACTGCTCCTTCCGGGGAATGGGTGGGTGACGGCCACGCGGGTATCCTTCACGCGGTCGTCGGTGGTTGGTGATCGGGTCTTGGGCCAAGTCG
ATCACGTGGGGGGTGTCCTTGGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGAGTAGACGATCG
CACCCTGGCCAAGCTATCCAGGTCTGCGTCGTGTCCTTGGTCGACTGGGTGGGTCCTTCGTCGGGTAGGCCAATGTAATTCCTTCCCCGGAAAGTATGGA
CGCCACTTGTGTCTTGCAAGGCAAATCTGAATCTCTTAACCAAAAGTAAAGGTCCTAAAGATCTCTCCCTATCCTGCTTTCTCCCTATCCCGCTTGCGCA
TCCCTTGATTGCACACCGTAGCTTGAACTTGGTCTGATGTACCAAGATCGCGGTACCGTGTCGAAAAGATTGGTCCATTGTACCCACAATAATCGTGAGT
ACAGATCGCGTATCGAAATGTTTGTCGCATGTCGATCTGGATCAGATTGCGTATCGAAATGATTGCTCAATATCGATCTTGGTCAGGTCGGCATAAATGA
TAACGCCATACTCATCAGGTCGACATGTATCCACTTCAATCCGGAGGTGGATGTCTTCTGAACACAACCGGACATAACTGGACACCACTGTACACAACTG
GCCATAACTGGACACACCCGCAATCTTTCCATCGCGATTCCTCCAAACGCGATCTCATGCCATCAGTCCCTTCCGAATCGCTCAATCTCTCCAACTGACA
AGTCGCTTCACCTCAAGTGCAACTAGATCCTTTCGAAGCTCGACGCCAATGCACGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCA
CACCAGCTCCAACATCGAGGAAAACGTCGGCTTCTCCGAGGGGTCCAACAGCTTCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCAGCATTGCC
ATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACTGATTCCTGCAAATATGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTATAGTTTCA
CGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCCACAGACTTGAATATGGTGTGGCTCACCGGCTCGGACGTGGTGTTGACCGCAGACGTGG
CTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCTGGGCATGGTAACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGCCTT
GGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGCAGCTGGTGACGGCGGTGTCACGGACAGACTTAGTGCGCATGACCTCGGTGTCG
GTGCTGCTCGCGGGCTGGTTGGGGCTGTTGCTCGCGGACTTGAAGGAGGACCCGGTGTCGGTGCCAATGGCAACACCACCGCCTGATCCGTTGGAAAGAC
TAGCCGAGGTTGTGGTGGAGGGCGTGAGGCCGAGACGGGGAGGTGGTGCGTGCGTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAGATGGCGGCGGCCG
AGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGCACCGCGGAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGACTGGCCAGC
CGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGCCACATATGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGAAGTGTGATCT
GGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTGCTAATTTTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTT
ATGTATGGCGATATGACTGGCTGCACGGTGATACTGGTGCTCATTGTTTTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGACCGATTACGGCG
GCTGAAGCAATAAAATACACCTCGGAGACGCGAGCATTTGAAAAATACCCCCATCCCTCTTAAACAAAATGCTGTGATTGGTAGTAATATTACACGGTAG
GTCGAGCGCGGGATTAGGCTAAAAGGGCGCAACAATCGCCCTTTTAGAAGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGC
CCTTGCACCGCGAAAGGGTTAATTAATTAGCTAAGTTCGCTTTCGTTAATTTGCTTAAGTTCCGACTTGCTTGAATATTTTTTTCTTACGAGCACGAATT
TCCGTTCGATGCTTCTCATCATATTCTCGCTGCTTCGCCAGTCGCGTTTCCCTTGTCTTTAGATAGTAGCGCCTTGATGCGCTCTTTATTAACCCCCCCA
ACGCGAGGGCCTGTATCAGACACGATTCTTCAAAATGCTTATCCTGTATCAGACACGTTAAGGATTCTATACTTGGAGTTTGTAAGGGAGCATACAAAGT
TGATGTCAAGGCGGGTTAGGTATGTATCCATTCCCTCTCAGCTCATCTACCATAGCCGTGCGATGACTCAGCCTCAGTATTTTGAGAAAATTAGCTTCCA
GAGGTAAATGGAGTAGCCACACACTAACCTATACAAAACCGCAGGTCATTTCTCACGCCACTCATTTCCCGCTCACTCTAGAATCCTCCCCCCTCGCCGC
ACGGATGTCGGGATTTCAAGCGCGCTGGCGTGAACTTCGCAAAGATGGCTGGACGTGGAAGCGGTCTGAGGGCCTGTCAAACGACGTGATCTACATCAAG
CCAGGGAAGACCAAGAAGGACGTTCGGGGCGTAGACGTCTTTGTGGGCGAGAAGGAAATCATGGAGTACTTGGACAACGTCGACTTAGGTATGTTTGTAT
GTAGGGGGTTCGAGCGGCTGATGTGGCACTAACAGAAGTAATGATGACAGCGGAGCTCGCGAGGAAGCAAGCCGAAGGTGGAGCCGCTTCGACCACGACG
TTAGGCGGCCAGGACGACCTGAATACTGGCGGTAAGGTGACTATCGTGTGTCAGACACGACATGGTTCAAATGCTAACGTGTCTGATGCAGGTACTGATA
ATCTCCCAAGTCACAACAGCGTATCGGAGGCTGGTGCCAGTGACCTTGTGCCTTCAGCAAGCGTATCGACTAATGCTCCACATGATGGAGGTGAGCCGAG
CTAGTATCGTGTCTTCTCATGTTTGTTACCTGACTCTATCGTGTATGATACAGTCAACCAAGGCATCGATAGACCCAGATCTCGCAGCAGCCCTCTCATC
GCGACCTCCACGCACATCGACGACAGAGACAACAGCTCCGCTGAAGCGGATGAAGAAGATGACGAGAGCATGCCAGGTACGCTGTTCGAGTACTGCTTGA
CTGAACGTTGTACTCACGAACGTATTGATGTTGACACTACAGCTCCCCGTCCTCTTCGGCGGCGATTGCGCAGCGAGTTCGAACATTTGCTTTCCTCGGA
CAGCGAACCTGACATCCCCGAATGCTCAGATGCTGAGGGTAATAGTTCGAGACGATGTGAAGATGAAGAAACGAAAGACGACTCAAACCAGCTAAGTCCG
CTCGATGGTATGCTTACGTTGTATTTCCATGTAATCGATACATGTTATTGATGCTATCGTGTACTTGGTTTTTGCAGATGACCCCAACATCATCTCACCT
GGAGATCGATTGGACAACTATACTGCGCTGGACTCGGATGGAGATAACGAAGGCGACTCCGTCTACGACGATGATGATGACCTCGGTCCCGAGGAGCCCG
ATCCAGTTGATGAAGATGCTCTTTACTCTCCAGACCTTCACTTTGAGCCGTCACTTCTTCAAAGAGTTGGCGGAGTTGCTGCCATCTCTCGTGGATCTGT
GGACGCACATGTTCTAACGGACATCAAGTTCAATGGATGGATCGGGCCAGAGAAGGAGACGCCGCTGCCGTACATGGACGAACCTTACGAGGAGCGACCA
GCCAACTGGATGAGCGTAGACTATCCTAACATCTTCACTGGAGAAGGCGGACCAACACTAGAAGCGATGAAAGCAGCATCGACTGCGTTGGGGGCGTTCT
TTTTGTTTGCTCCTCCACAACTGTGGGAGACTATTGCTGGGGCCAGCGATGACTACTTCGAAGCCAATCTCGACAAGCGTGTCGCTGCTCAACACGCAAA
ACAAGAGGCGCGACAACGCAAACAACCTAGCTTCCAAGTCCAGTCGCCTGCAGAGATCAAAGAGCATTTGGA