Description :
From Genome Similarity Track
Location :
Scaffold_1325:2973- 5809
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1325-snap-gene-0.3Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1325-fgenesh-gene-0.1Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
2836 bases(100 bases per row)
CACCACCGGTCCCGCACTTGACTGAGAAGTACGACCCCGAGCACCCGGACGCAGACTGGGGTGGCTTCGTTCAGCGCTCGTACAAGAAGCGGTTCTACGA
CGACCACTCGTCCACGAAAGATGTGAGTGCTCTACTTACTTTTGGGGCCGACTGCTGTATTAATTGTAAAGGCTAATCTATGCGTGTATCCTCTATAGAA
CCTTGTGTACGATGACAAAGGAGGGCTCATGCCGGACCGGTCCGCAGCGATTTCCAACAACGCTGGCAAGAGACTCTTTGAGCCGCATCAAGTCCCTGTT
GGCGACGCAGTATGCTGCTTCTCATTACTTGTGATCATGGCTCACCTAAGGAGGTATGAGTTGGTCTAACGCCCATGTCGTTCGTGTTGCTAGAGTGTCC
CTGGTATCCCTTTCCAAAGCGCTGTGTACCAGGTATGCTACAAAAGCACCGAAACTCAGTTTTTGCGATCGTACATTAATGTGAATGTGTATGCATGGCA
ACACAGGTGGGACCAGGCTGCGATGTCAGTGCAAATGGCTGGAAAACGTACGTGTACCAACATCTTCGTTCGCTCAGAACATCAGTCCTCTGTGGCAACG
CCATCAACCAAGACTGACAAGCAAATTGCAGGAGCTACGCGTCCCAGATATCAATGGAAGCGACGCCCAAGGACGTGTATGCGCTCGGCACAAGACACAA
CTCCCAGCACAAACGCCACTTGACGCCGCTAGTACGTGGTGCTTGGTATTTTAACCATCTTTCTCTGTCTTTTTACAAGATGCTCACTCTGCATCACTGT
CGTCCGTAGTACGAGAAATCACTCCAAGACCGGAAAAGTTCTGGAAGAAGCGGCTCTCCGTTTGCAAAAGATGCAGAACTCGGCACCAGCTCTAGCAACG
GATCGCTCTCGGGTAGAAGAGTGGACTCGAAGCGCTCGCTGCTCGCCGGGATAGGGAAACTGGTCGCGGCGGAAAACCTTGGCGAGAAGCTCATGTACAT
TGCATCCTACACGACGATATGCAATTTCTGGCATGGCGTTTGTGCTCTAACATGCGAATATGTGCGTTGGCTATGCGGTGGTGGCTGAGCGCAGGAGTCC
AGAGCTTCATCTTTCCCAGAGCTACGCAGATCCTTCGCAGAAGACCCTCCTGGCAGAGAACTAGTACGTTTTCTTCGCATACATGCTATCATATGACGGG
TTTCTCGGTGTTTCTGATCAGTCAAGTTTGGATGAATGTCAACAGCCATGGCGTGAAACTTGGATATACGAGGAGACGCAATCCTTCGAGGTTCTAATAC
GAATGGCGAGCACTGGATGTGGGCGCGTCAATCTGAAACAAAAGCGCTGGGATGACTGTGCGGCAGACATGGTAAAAGAAAATGGATTGGACTAGGTGCT
TGTTTATGGTGTTTTTGTTTGCTTTTAGACCCAGATGCTCTCTTGTGTAGCCTCATTTGTCGCTTGCTCCAGTGCGAATGACCGCCTTCGAAGCCACCCC
TGTCTTCTGCCTACATCGAGTACATCTTGACTTTGAAGAAGAAAAAGCTGATGAGCACCCCAAGGAACGAGATCGCACCGCCCACGAACACTGGGAGCGC
GTATCCGAGCGACGTTTGAACGAGCGCAGCGCTGGCGACAAAGTTGAGCAGCTGGCCCAAGCAGTTGGCCGAGTTTACCGCGCCAACGTGCATGCCCACT
TCTGCTCGGTCGCCAAACACGTGGAGAAGCAGTGGCACGATCAGCGCGAAGCTCGTAGCTTGCGTGATCGACGTCAGCGCAACGATCACGACGTTGAGTG
GCACGCACTCGGAGAACGCCATCGCCATGAGCAGCGCCTGCGGAATTGCCGCCAGTGTCATCGCCCAGCGTGCACCGATGCGGTAGACGATGAACGGGAG
CATCCACGAGTACACGTACCCGGCAATGTTGAAAATCATGTCCGCGAGGCCTCCTGCCAGCTGCACGCCGTGGTTGTAACGTTTTTGCTCGAGCGAGCAG
CTCTCCTTGCAGGTGTCAGCATTGTTCGCGTTCCCGTGGAACACTTCGACGCCAAAGAACTGTCCCTTGCTGCCGTTGTACGCCGTGAAGCCGTACTGGA
CCGTGAAGAAAACAATGCAGTAGACGATGAGTACGCGTGGGAGCGTACGAAGTCCGTGGATGATCGTGCCAAACGCTTGTGCGACGCGCGTGAACATCGT
CACGTGATCTTGCGGATCCTTGGCGCGCGGGATCTCCTTTGCAAACAGGCACACAGCGCCGACGGTGGTGACCATTGTCACCGAGAGCATGCCGAGGAAC
CAGCGGAGCGTGAGATGAGCGGCGCCAAAGAAGTAGATGTACCCGGCGATCATGATCGAGCCCAAAGTGGAGCTCGCTTGTCCAATGCCCGCGCCGAGTG
TCTGCCGCTCACCAGCGAAGTCAGCGATGATCAAGATCGCCGGAGTCTGCACGACGTTGACCGTGATATCCATCCATGTGTAGAAGAAGATCGTGAACAA
TGAAGTCCAGAGTCGGTGATCACCTTTGTCACCCAGCGCCTCGCCGATCGAGCGCGTGTAGCCCATCATGGTCCAACAGATTGCGCTCGTGATGGCTCCG
TAGAGCAAGTAAGGACGGCGCCGCCCCCACCGATTCGTGCTGCGGTCGCTCAGCACGCCAATCGTCGGTGCGACGAGGATGCCCGAGAGCGGACCGATGA
TCTGCGTCAACTGGACAGCGTATGGTGGCAGCATTGTGCCCAAGTACGGACCGAGCGCAGCCCATTGCGCCGCCCACGCCATGTTGGTAGCCATTCGCGG
CAGCGAGAGAAGCACGAGCATTGCGACCGAGCAGCC