Description :
From Genome Similarity Track
Location :
Scaffold_18:297297- 298472
Transcript NameFunction/comments
Phyca_LT153416154oligopeptidase A, putative

Sequence
1175 bases(100 bases per row)
ccgcggcaggcctcgaacacctgctccgggtgctgaccgccgccgcgggccagaattgtgtcacggaacttgcgaccaacgcgcgcctgagcctcggggc
tctccttagcagcctcctcgaaagcgccgtacgcatcacacgacaggatttccacccacttgtagcagcagataaacaagcaccagagttagttgtgcgt
tcgttcactgttgacacgttgcatttgtcagcgaacgtacctgtaacagccggccgcatagccgcctgcgaagatgtgtgcaaaagagcagaggaacctg
tcttcctccagtggattcagccggcgcgtagtgcgagtgtaggtacatgtctagcgcgccgaagcccagctgacgcgacatgcccgtggccaccatacag
ttatgcgctaccttgagcttctcgaagagctcatccggcagcggttcgccagtcttgaagtgtccgctgatctctgcctccacttcacggaacgtcccat
gaggctcggagtttcgcccacaggtggcgactgcttacagatgatataggccacaggaacgtgcttgcctccttgctcctcaggaccaagtaggcggcta
cgatccacgcaagtgttcatccaagcgccaccgttcaagaaaaatcgggcgacaatctccttgtcgccttcagtgctacggacattgaaaaaacgtacgt
ccgggttccaaacctctgcctggccgtcagcggcctcgatctccacaccaaataaccgtgatgtcagcgagaacaagccatccagcacctacacgtaagc
aatattagtcctcaagctaaggtgcattggtatctcaagaaaacaaagacgtacgcgctcaagtgggaagtaaggtttgatctcctcatctgtgaaccga
tacttctccgccttcaccctttcagacctgttcgcaaaatgcatagataccgtaagttactggcagtaactgcacaatgagatgatgcgaatgttttagc
aacgtaccagtaaccaagatcccaggacgagaggggttccgtttgtccgtgctgctttgcgtgctcggcaacagtattcacctcttcgtgggcaatggca
atgcattttcacgcagatcgtggtgcatcttttccacttcttccacactcggcgccattttcttggttatgctca